Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1882 bp · TkA07G176520|TK1151|cDNA
TGGCAATGGTAGCCTGAAAATATATTTCCAAATACAAAAATACTGTGTTTGTAGAGGGGAAGGGTCGATGTTTCCAGATTGGGGTTTTTTTTGAACGTGAAACCGCTCTTTCAAGAGATTTTGCCCTCCCTTCCTCTACGGTATTGGTCGTCTCATGATCTGACCTCCGTTATCTCTCGAAATCGAAACCCCGAAGCAAACCCTTCTAAACTTTTCATCAAATCCCATTTGAAACCCAGTCTCCAAATTCTCAATGTCTT...
1338 bp · TkA07G176520|TK1151|CDS
ATGTCTTCGTCCACTGTCTCAATCACTGCGAACCCTTCTGGTGCTGTGCTGCGTAGACCTTTACTCACCGGTGAGAAAAAATCCGGCGTAGATTTGGGCGGCAGTGATGGAATTGAAGCATCTGCGCGAAGCGGCGGCGAAACTAGCAGAGGGAAAGATCTCAGCCATTCATTCAGAGCAGGAGCAGAAACCGTTCTCGAAAGATCTAGAGACGCTGTTCAAACGAAGAACCCCTTACCCACGAATTCAACCACCAAGAC...
Protein
Download Protein FASTA445 aa · TkA07G176520|TK1151|PROTEIN
MSSSTVSITANPSGAVLRRPLLTGEKKSGVDLGGSDGIEASARSGGETSRGKDLSHSFRAGAETVLERSRDAVQTKNPLPTNSTTKTRKRTADKKVSVPSTTKAPWKRAVSVLMKNFALLVILLLLAQMIRKLAFNQGSGFDSILIPSSDYESQFAEVEARLKSTTQAMQFQVDVMNQKMVEEIVGLKTELTKRIADKGAELSSRVNDLDGKFQTMKKTLTTDWLSRDEFNRFVEDFKSKKGMDDVNKLNLDEVRAFAKE...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA07G176520 |
|---|---|
| TK1151 ID | TkA07G176520 |
| OH-1004 ID | LXL04_028633 |
| Relationship / confidence | Rbh Sequence Supported / Probable |
| Protein identity (%) | 99.500 |
| Protein coverage (%) | TK1151 97.978 / OH-1004 74.150Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA07G176520 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr07:45139199-45141386 (-) | |||||||||
| Description | Similar to SUN1: SUN domain-containing protein 1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006997 nucleus organization Biological Process GO:0051260 protein homooligomerization Biological Process GO:0051291 protein heterooligomerization Biological Process GO:0070197 meiotic attachment of telomere to nuclear envelope Biological Process GO:0090435 protein localization to nuclear envelope Biological Process GO:2000769 regulation of establishment or maintenance of cell polarity regulating cell shape Biological Process GO:0005634 nucleus Cellular Component GO:0005635 nuclear envelope Cellular Component GO:0005637 nuclear inner membrane Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0005819 spindle Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT3G10730 ath:AT5G04990 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF03938OmpH150-244 aaPF02961SAM_BAF167-225 aaPF19788DUF6272241-287 aaPF07738Sad1_UNC311-440 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA07G176520 | PF03938 | OmpH | 150 | 244 | 0.15 | 13.0 |
| TkA07G176520 | PF02961 | SAM_BAF | 167 | 225 | 0.027 | 15.7 |
| TkA07G176520 | PF19788 | DUF6272 | 241 | 287 | 0.037 | 14.4 |
| TkA07G176520 | PF07738 | Sad1_UNC | 311 | 440 | 1.2e-38 | 132.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.