TkA07G172000 | RubberDandelionOmics

Gene overview

TkA07G172000

Reference: TK1151 Chr: Chr07 Coordinates: 44147415-44152389 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2699 bp · TkA07G172000|TK1151|cDNA

CGTCTCAATTTTATTTCGTATCATGTCATGAATCGCCATCCGTAAATAAAAGCCAAGGAAACGAACGCACCATCTAGTCCTCTCTGGCTATGTAACTATGCACACAAAAACCTTACTATATATAATATTCCATCTATCTCTATATCATTCAACCTCCACTTCTCTATATACCCATCAAGAATTAGAAATGAGGTTCCTGGTTATTACTCTCCTGGTTCTATTGGTGGTGGTGGCCACTTCCTCCTTGGCTCAAGAACACC...

CDS

Download CDS FASTA

1767 bp · TkA07G172000|TK1151|CDS

ATGGCGTCTGCTAATGCAATATTTACAGCTTCAATGCTCCCATCATACAAAAAGGGGAGTTTGGTTGATGGTAGTAGGAGGATTACTCAATTTCAGACTGTTCAGAAGATGAGGCAATCGAATCGCCGGTTTGTGGTTCGTGCTGCGGCTAAAGATATTGCGTTTGACCAGCTTTCGCGGGCGGCTATGCAGGCTGGAATCGATAAACTTGCGGACGTTGTTGGACTTACTCTCGGCCCTAGAGGGAGGAATGTCGTTTT...

Protein

Download Protein FASTA

588 aa · TkA07G172000|TK1151|PROTEIN

MASANAIFTASMLPSYKKGSLVDGSRRITQFQTVQKMRQSNRRFVVRAAAKDIAFDQLSRAAMQAGIDKLADVVGLTLGPRGRNVVLDEYGSPKVVNDGVTIARAIELPDAMENAGAALIREVASKTNDSAGDGTTTASVLAREIIKLGLLSVTSGANPVSLKKGIDKTVVGLIEELEKRARPVKGREDIRAIASISAGNDDVIGTMIADAIDKVGADGVLSIESSSSFETTVDVEEGMEIDRGYISPQFVTNPEKLLVE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G172000`
TK1151 ID	TkA07G172000
OH-1004 ID	LXL04_002116
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	52.200
Protein coverage (%)	TK1151 92.177 / OH-1004 90.381 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G172000

Location Chr07:44147415-44152389 (+)

Description Similar to RuBisCO large subunit-binding protein subunit beta, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g28000`	Binds RuBisCO small and large subunits and is implicated in the assembly of the enzyme oligomer.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002116 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006457 protein folding Biological Process

GO:0009409 response to cold Biological Process

GO:0009627 systemic acquired resistance Biological Process

GO:0042026 protein refolding Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0010319 stromule Cellular Component

KEGG gene cross-reference

ath:AT1G55490

ath:AT3G13470

ath:AT5G56500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.966

Rank 1 · TkA07G172000 · TK1151

Mitochondrion0.061

Rank 2 · TkA07G172000 · TK1151

Cytoplasm0.027

Rank 3 · TkA07G172000 · TK1151

Peroxisome0.015

Rank 4 · TkA07G172000 · TK1151

Nucleus0.014

Rank 5 · TkA07G172000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30524PlmA_C39-71 aa

PF14448Nuc_N59-70 aa

PF00118Cpn60_TCP170-572 aa

PF14448Nuc_N215-232 aa

PF30524PlmA_C256-283 aa

PF27267LdmS_N361-416 aa

PF30524PlmA_C369-404 aa

PF14448Nuc_N380-398 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G172000	`PF30524`	PlmA_C	39	71	1.2	9.9
TkA07G172000	`PF14448`	Nuc_N	59	70	0.56	10.8
TkA07G172000	`PF00118`	Cpn60_TCP1	70	572	7.8e-75	253.1
TkA07G172000	`PF14448`	Nuc_N	215	232	0.56	10.8
TkA07G172000	`PF30524`	PlmA_C	256	283	1.2	9.9
TkA07G172000	`PF27267`	LdmS_N	361	416	0.11	12.9
TkA07G172000	`PF30524`	PlmA_C	369	404	1.2	9.9
TkA07G172000	`PF14448`	Nuc_N	380	398	0.56	10.8
TkA07G172000	`PF30524`	PlmA_C	548	573	1.2	9.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P21238`	Arabidopsis thaliana	sp\|P21238\|CPNA1_ARATH Chaperonin 60 subunit alpha 1, chloroplastic	82.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card