TkA07G166700 | RubberDandelionOmics

Gene overview

TkA07G166700

Reference: TK1151 Chr: Chr07 Coordinates: 42816130-42818673 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1569 bp · TkA07G166700|TK1151|cDNA

ATGTTGCCGTCAGAAATCCAGGTATCTGCAGCGGCGGAAGTGGTGGCGGCAGCCTACGAAGCCATGACCAATGCGTTGGTGAAGAATTCCCGTCACACGGTTTCACTAGTCTTTGACGAAAGGAATATCACAAACGCCGGCTCAACCATGCGGAGAAACTCACGTAGGTCGGGCAGATATGTCAATGCTAGAAACAAATCCCCCGTCATTACAACCTCCGCCATTGCCGGCTTACTGAAAGCTCTTCTTTTGTCCAAATC...

CDS

Download CDS FASTA

1569 bp · TkA07G166700|TK1151|CDS

ATGTTGCCGTCAGAAATCCAGGTATCTGCAGCGGCGGAAGTGGTGGCGGCAGCCTACGAAGCCATGACCAATGCGTTGGTGAAGAATTCCCGTCACACGGTTTCACTAGTCTTTGACGAAAGGAATATCACAAACGCCGGCTCAACCATGCGGAGAAACTCACGTAGGTCGGGCAGATATGTCAATGCTAGAAACAAATCCCCCGTCATTACAACCTCCGCCATTGCCGGCTTACTGAAAGCTCTTCTTTTGTCCAAATC...

Protein

Download Protein FASTA

522 aa · TkA07G166700|TK1151|PROTEIN

MLPSEIQVSAAAEVVAAAYEAMTNALVKNSRHTVSLVFDERNITNAGSTMRRNSRRSGRYVNARNKSPVITTSAIAGLLKALLLSKSSHKITTIPITPISIPSQNHRYEPTTTQEHPTCHQHVLPSTTKHRHENQKLSKRILQWVEELHKEVKKEKELKSMYKIRLERTQDYLKYCLQVAQDNGFLDLILNKKDNPQESSSTHSSAIVQASTNPQTPPNVAKNTNLLALIEQAKLNGWYIDPQEIELHKKVAQGSTAEIY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G166700`
TK1151 ID	TkA07G166700
OH-1004 ID	LXL04_028538
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	90.300
Protein coverage (%)	TK1151 100.000 / OH-1004 97.317 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G166700

Location Chr07:42816130-42818673 (-)

Description Similar to STY17: Serine/threonine-protein kinase STY17

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g35780`	Serine/threonine protein kinase that specifically phosphorylates chloroplast precursor proteins in the cytosol within the cleavable presequences (transit peptides).	A protein kinase family in Arabidopsis phosphorylates chloroplast precursor proteins.2006 · DOI: 10.1074/jbc.m606580200 The cytosolic kinases STY8, STY17, and STY46 are involved in chloroplast differentiation in Arabidopsis.2011 · DOI: 10.1104/pp.111.182774
`At4g38470`	Serine/threonine protein kinase that specifically phosphorylates chloroplast precursor proteins in the cytosol within the cleavable presequences (transit peptides).	A protein kinase family in Arabidopsis phosphorylates chloroplast precursor proteins.2006 · DOI: 10.1074/jbc.m606580200 The cytosolic kinases STY8, STY17, and STY46 are involved in chloroplast differentiation in Arabidopsis.2011 · DOI: 10.1104/pp.111.182774
`At2g17700`	Serine/threonine protein kinase that specifically phosphorylates chloroplast precursor proteins in the cytosol within the cleavable presequences (transit peptides).	A protein kinase family in Arabidopsis phosphorylates chloroplast precursor proteins.2006 · DOI: 10.1074/jbc.m606580200 The cytosolic kinases STY8, STY17, and STY46 are involved in chloroplast differentiation in Arabidopsis.2011 · DOI: 10.1104/pp.111.182774
`At1g73660`	Acts as a negative regulator of salt tolerance.	The genetic locus At1g73660 encodes a putative MAPKKK and negatively regulates salt tolerance in Arabidopsis.2008 · DOI: 10.1007/s11103-008-9306-8 SIS8, a putative mitogen-activated protein kinase kinase kinase, regulates sugar-resistant seedling development in Arabidopsis.2014 · DOI: 10.1111/tpj.12404

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028538 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0007165 signal transduction Biological Process

GO:0009190 cyclic nucleotide biosynthetic process Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0016020 membrane Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0004712 protein serine/threonine/tyrosine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT2G17700

ath:AT4G35780

ath:AT4G38470

vg:9925495

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.472

Rank 1 · TkA07G166700 · TK1151

Cell membrane0.284

Rank 2 · TkA07G166700 · TK1151

Nucleus0.263

Rank 3 · TkA07G166700 · TK1151

Golgi apparatus0.083

Rank 4 · TkA07G166700 · TK1151

Endoplasmic reticulum0.069

Rank 5 · TkA07G166700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13581HATPase_c_28-33 aa

PF00790VHS22-38 aa

PF00790VHS129-164 aa

PF00069Pkinase136-150 aa

PF03109ABC1140-156 aa

PF00790VHS185-210 aa

PF07714PK_Tyr_Ser-Thr245-509 aa

PF00069Pkinase246-507 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G166700	`PF13581`	HATPase_c_2	8	33	0.15	12.8
TkA07G166700	`PF00790`	VHS	22	38	1.1	9.9
TkA07G166700	`PF00790`	VHS	129	164	1.1	9.9
TkA07G166700	`PF00069`	Pkinase	136	150	6.9e-45	154.2
TkA07G166700	`PF03109`	ABC1	140	156	0.0016	18.4
TkA07G166700	`PF00790`	VHS	185	210	1.1	9.9
TkA07G166700	`PF07714`	PK_Tyr_Ser-Thr	245	509	1.1e-42	146.9
TkA07G166700	`PF00069`	Pkinase	246	507	6.9e-45	154.2
TkA07G166700	`PF03109`	ABC1	250	278	0.0016	18.4
TkA07G166700	`PF01636`	APH	356	400	0.026	15.0
TkA07G166700	`PF03109`	ABC1	373	408	0.0016	18.4
TkA07G166700	`PF13581`	HATPase_c_2	387	406	0.15	12.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RWL6`	Arabidopsis thaliana	sp\|Q8RWL6\|STY17_ARATH Serine/threonine-protein kinase STY17	40.500%	Swiss-Prot	Medium
`F4JTP5`	Arabidopsis thaliana	sp\|F4JTP5\|STY46_ARATH Serine/threonine-protein kinase STY46	40.500%	Swiss-Prot	Medium
`O22558`	Arabidopsis thaliana	sp\|O22558\|STY8_ARATH Serine/threonine-protein kinase STY8	40.300%	Swiss-Prot	Medium
`Q9C9U5`	Arabidopsis thaliana	sp\|Q9C9U5\|SIS8_ARATH Probable serine/threonine-protein kinase SIS8	37.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card