LXL04_028538 | RubberDandelionOmics

Gene overview

LXL04_028538

Reference: OH-1004 Chr: Chr06 Coordinates: 44811641-44814843 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1680 bp · LXL04_028538|LXL04_028538|OH1004|cDNA

atgatCAAACAAAACCTAGACATAGCGGCTTCTCCAGATGGCCAGATGTTGCCGTCAGAAATCCAGGTATTTGCAGCGGCGGAAGTGGTGGCGGCAGCCTACGAAGCCATGACCAATGCGTTGGTGAAGAATTCCCGTCACACGGTTTCACTAGTCTTTGACGAAAGGAATATCACAAACGCCGGCTCAACCATGCGGAGAAACTCACGTAGGTCGGGCAGATATGTCAATGCTAGAAACAAATCCCCCGTCATTACAAC...

CDS

Download CDS FASTA

1680 bp · LXL04_028538|LXL04_028538|OH1004|CDS

ATGATCAAACAAAACCTAGACATAGCGGCTTCTCCAGATGGCCAGATGTTGCCGTCAGAAATCCAGGTATTTGCAGCGGCGGAAGTGGTGGCGGCAGCCTACGAAGCCATGACCAATGCGTTGGTGAAGAATTCCCGTCACACGGTTTCACTAGTCTTTGACGAAAGGAATATCACAAACGCCGGCTCAACCATGCGGAGAAACTCACGTAGGTCGGGCAGATATGTCAATGCTAGAAACAAATCCCCCGTCATTACAAC...

Protein

Download Protein FASTA

559 aa · LXL04_028538|LXL04_028538|OH1004|PROTEIN

MIKQNLDIAASPDGQMLPSEIQVFAAAEVVAAAYEAMTNALVKNSRHTVSLVFDERNITNAGSTMRRNSRRSGRYVNARNKSPVITTSAIAGLLKALLLSKSSHKITTIPNTPISIPLQNHRQPPKSIPLATNMSSPQPPNTATKTRSSRKGFCSGFGDCMTKPTIASSPPSQSYSRLELQVEELHKEVKKEKELKSMYKIRLERTQDYLKYCLQVAQDNGFLDLILNKKDNPQESSSTHSSAIVQASTNPQTPPNVAKN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_028538`
TK1151 ID	TkA07G166700
OH-1004 ID	LXL04_028538
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	90.300
Protein coverage (%)	TK1151 100.000 / OH-1004 97.317 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_028538

Location Chr06:44811641-44814843 (-)

Description Similar to STY17: Serine/threonine-protein kinase STY17

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g35780`	Serine/threonine protein kinase that specifically phosphorylates chloroplast precursor proteins in the cytosol within the cleavable presequences (transit peptides).	A protein kinase family in Arabidopsis phosphorylates chloroplast precursor proteins.2006 · DOI: 10.1074/jbc.m606580200 The cytosolic kinases STY8, STY17, and STY46 are involved in chloroplast differentiation in Arabidopsis.2011 · DOI: 10.1104/pp.111.182774
`At4g38470`	Serine/threonine protein kinase that specifically phosphorylates chloroplast precursor proteins in the cytosol within the cleavable presequences (transit peptides).	A protein kinase family in Arabidopsis phosphorylates chloroplast precursor proteins.2006 · DOI: 10.1074/jbc.m606580200 The cytosolic kinases STY8, STY17, and STY46 are involved in chloroplast differentiation in Arabidopsis.2011 · DOI: 10.1104/pp.111.182774
`At2g17700`	Serine/threonine protein kinase that specifically phosphorylates chloroplast precursor proteins in the cytosol within the cleavable presequences (transit peptides).	A protein kinase family in Arabidopsis phosphorylates chloroplast precursor proteins.2006 · DOI: 10.1074/jbc.m606580200 The cytosolic kinases STY8, STY17, and STY46 are involved in chloroplast differentiation in Arabidopsis.2011 · DOI: 10.1104/pp.111.182774

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028538 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0007165 signal transduction Biological Process

GO:0009190 cyclic nucleotide biosynthetic process Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0016020 membrane Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0004712 protein serine/threonine/tyrosine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT2G17700

ath:AT4G35780

ath:AT4G38470

vg:9925495

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.479

Rank 1 · LXL04_028538 · OH-1004

Cell membrane0.342

Rank 2 · LXL04_028538 · OH-1004

Nucleus0.246

Rank 3 · LXL04_028538 · OH-1004

Golgi apparatus0.075

Rank 4 · LXL04_028538 · OH-1004

Endoplasmic reticulum0.053

Rank 5 · LXL04_028538 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07714.24PK_Tyr_Ser-Thr282-546 aa

PF00069.32Pkinase283-544 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_028538	`PF07714.24`	PK_Tyr_Ser-Thr	282	546	1.4e-42	146.5
LXL04_028538	`PF00069.32`	Pkinase	283	544	1.2e-44	153.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RWL6`	Arabidopsis thaliana	Serine/threonine-protein kinase STY17	40.502%	Swiss-Prot	weak database homology
`F4JTP5`	Arabidopsis thaliana	Serine/threonine-protein kinase STY46	40.502%	Swiss-Prot	weak database homology
`O22558`	Arabidopsis thaliana	Serine/threonine-protein kinase STY8	37.615%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card