Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1312 bp · TkA07G164940|TK1151|cDNA
CCCCACTCCGCGCACCCTAAAATAACCGAAGAGGTGTTCACACTTTACCCTTTACGTTGCAGTTGGTACTTGAGATCGAGACGGTGTTCGTACAGCGTGACTCGAAACTTCCGAGGATTGCAGGTTTCCCCTTACGCAAGACACCATCTCTTGATATAACGTTCGAGAGAAATTATAATCCCATTCGTCAATCAAATTCGCTATTCAGAAACAAAGTGATTTAGGGTTTATCTGATTTCCACAATTCCATTACTGACTAG...
1020 bp · TkA07G164940|TK1151|CDS
ATGGAACGCGAGGATGAGTTGAAGCAGAAATTGCAAGATTTACAGAAGCAACTAGGGAAAAAGCAAATGTTCGAAGAGTCTGTCTCTTCAATCAGATCTTTGCTCCATCAATTTTACCCTTCCGCTTCACCTTCTCTTCGTAAATCGTTTTTCACAGTCATATCTCGTGTTGCAACCATACTAAAGACAAGATACACCTCACCTGGATTTTGGAACACCGGATTAGGGCTCTTTCTAGAAGCTGAACAAATGGTGTCCGA...
Protein
Download Protein FASTA339 aa · TkA07G164940|TK1151|PROTEIN
MEREDELKQKLQDLQKQLGKKQMFEESVSSIRSLLHQFYPSASPSLRKSFFTVISRVATILKTRYTSPGFWNTGLGLFLEAEQMVSESSEKQHLKTCILRAREQLTEIDNQPDESPQNTRHQGYLFEGHLTVDQEPPQPQWLVQSNLMTALAATMSQGDTSSSQSDGPTTLPVELMDRLQELMPNTSPDSNDLPQEIIDQLLAMFPEGNSAAGAPPASKEVVAKLPVIVVTDEILVKLGLDAECAICKENLVVNDSMQEM...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA07G164940 |
|---|---|
| TK1151 ID | TkA07G164940 |
| OH-1004 ID | LXL04_028515 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 98.000 |
| Protein coverage (%) | TK1151 89.381 / OH-1004 89.911Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA07G164940 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr07:42342362-42344808 (-) | |||||||||
| Description | Similar to AIP2: E3 ubiquitin-protein ligase AIP2 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0009737 response to abscisic acid Biological Process GO:0009738 abscisic acid-activated signaling pathway Biological Process GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process GO:0016567 protein ubiquitination Biological Process GO:0035519 protein K29-linked ubiquitination Biological Process GO:0044314 protein K27-linked ubiquitination Biological Process GO:0090378 seed trichome elongation Biological Process GO:1905168 positive regulation of double-strand break repair via homologous recombination Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT3G19950 ath:AT5G20910 xla:432033 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF06387Calcyon34-77 aaPF13923zf-C3HC4_295-101 aaPF12678zf-rbx1241-285 aaPF13920zf-C3HC4_3242-288 aaPF17120zf-RING_16242-282 aaPF29452FAR1_N242-293 aaPF13771zf-HC5HC2H242-272 aaPF13639zf-RING_2243-285 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA07G164940 | PF06387 | Calcyon | 34 | 77 | 0.11 | 13.3 |
| TkA07G164940 | PF13923 | zf-C3HC4_2 | 95 | 101 | 1.1e-08 | 35.4 |
| TkA07G164940 | PF12678 | zf-rbx1 | 241 | 285 | 3e-06 | 28.1 |
| TkA07G164940 | PF13920 | zf-C3HC4_3 | 242 | 288 | 0.00027 | 21.4 |
| TkA07G164940 | PF17120 | zf-RING_16 | 242 | 282 | 0.14 | 12.5 |
| TkA07G164940 | PF29452 | FAR1_N | 242 | 293 | 0.17 | 12.6 |
| TkA07G164940 | PF13771 | zf-HC5HC2H | 242 | 272 | 0.36 | 11.8 |
| TkA07G164940 | PF13639 | zf-RING_2 | 243 | 285 | 2e-13 | 51.1 |
| TkA07G164940 | PF13923 | zf-C3HC4_2 | 243 | 284 | 1.1e-08 | 35.4 |
| TkA07G164940 | PF17123 | zf-RING_11 | 243 | 271 | 2.9e-07 | 30.8 |
| TkA07G164940 | PF14634 | zf-RING_5 | 243 | 286 | 0.0013 | 19.4 |
| TkA07G164940 | PF21302 | Zn_ribbon_RlmA | 243 | 266 | 0.2 | 12.4 |
| TkA07G164940 | PF24441 | DUF7560 | 243 | 260 | 0.22 | 12.0 |
| TkA07G164940 | PF26148 | VPS18_RING_C | 243 | 272 | 0.31 | 11.9 |
| TkA07G164940 | PF14446 | Prok-RING_1 | 243 | 272 | 0.42 | 11.5 |
| TkA07G164940 | PF11793 | FANCL_C | 243 | 279 | 1.3 | 10.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.