TkA07G145970 | RubberDandelionOmics

Gene overview

TkA07G145970

Reference: TK1151 Chr: Chr07 Coordinates: 37714187-37717532 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1701 bp · TkA07G145970|TK1151|cDNA

GGAAAAGGTGAACATAGCGGAAAAGGAAGGCGAACATAGCGGGTCGTCGCCTTCTAGCTTCCTGAATGTCGATTTCGAAATTGAACATTTGAACCGCTCCCAACTCACACGCGACCGCCTCCGCTCCTCCGCCTCCGGCCTCTCGTCGACGACGACCCTCCGCAGTCCGCTCTTCCAGAATCGATTCCGTCGCACGGTCGCAGCGCACCGTTTCTCTGCAGACTGTGCTCCGCTCCTGTCGATACATTGCTCCGCTGCCT...

CDS

Download CDS FASTA

1143 bp · TkA07G145970|TK1151|CDS

ATGGAATCAACTGACACTACGAACTTCGATCTCAGATCCAGCTTCGGAGCGAGTGAATACACATTTGCCGATGTTGAAAATTTGGATCATTGTGCCAAGTATTTGAACCAGACTTTAGTCACATTTGGATTTCCAGCTTCTCTGGATCTGTTTGCAACTGATCCGGTTTCAATTGCGAGGACTTGCAATTGCTTATACTCACTGTTGCAGCAAAGGCAACGTGATATTGAATTTCGAGAATCTACCAATGATCAGAGACA...

Protein

Download Protein FASTA

380 aa · TkA07G145970|TK1151|PROTEIN

MESTDTTNFDLRSSFGASEYTFADVENLDHCAKYLNQTLVTFGFPASLDLFATDPVSIARTCNCLYSLLQQRQRDIEFRESTNDQRQRLSSDISRLEAKVERLEAQLSAKDREIATITRTEAKAKAGLKAQIDKLQQERDEFQRMVIGNQQVKTQQIHEMKKKEKEYIKLQERLNQVMMEKKKESRSGMEIMNLLQKEGRQRGTWNGKKADNDFYKKIVDAYEAKNQELVAENADLRALLRSMQVDMREFLNAPNGSSKH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G145970`
TK1151 ID	TkA07G145970
OH-1004 ID	LXL04_028356
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G145970`
Location	Chr07:37714187-37717532 (+)
Description	Similar to Ssx2ip: Afadin- and alpha-actinin-binding protein
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_028356` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0007098 centrosome cycle Biological Process GO:0007155 cell adhesion Biological Process GO:0030036 actin cytoskeleton organization Biological Process GO:0035020 regulation of Rac protein signal transduction Biological Process GO:0035735 intraciliary transport involved in cilium assembly Biological Process GO:0060271 cilium assembly Biological Process GO:2000145 regulation of cell motility Biological Process GO:0001669 acrosomal vesicle Cellular Component GO:0005634 nucleus Cellular Component GO:0005813 centrosome Cellular Component GO:0005874 microtubule Cellular Component GO:0005912 adherens junction Cellular Component
KEGG gene cross-reference	hsa:117178 mmu:99167 rno:308023 xla:431833 xla:431921 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.677

Rank 1 · TkA07G145970 · TK1151

Nucleus0.212

Rank 2 · TkA07G145970 · TK1151

Golgi apparatus0.160

Rank 3 · TkA07G145970 · TK1151

Lysosome / Vacuole0.083

Rank 4 · TkA07G145970 · TK1151

Cell membrane0.068

Rank 5 · TkA07G145970 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11559ADIP30-176 aa

PF11690DUF328755-117 aa

PF30835CEP83_CC_2nd79-177 aa

PF25481Nucleoprot-TPR85-144 aa

PF16559GIT_CC88-106 aa

PF07558Shugoshin_N89-105 aa

PF01863YgjP-like89-176 aa

PF16378DUF498891-120 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G145970	`PF11559`	ADIP	30	176	1.2e-48	165.8
TkA07G145970	`PF11690`	DUF3287	55	117	0.13	12.8
TkA07G145970	`PF30835`	CEP83_CC_2nd	79	177	2.8	7.8
TkA07G145970	`PF25481`	Nucleoprot-TPR	85	144	0.0093	16.7
TkA07G145970	`PF16559`	GIT_CC	88	106	0.4	11.1
TkA07G145970	`PF07558`	Shugoshin_N	89	105	0.029	14.9
TkA07G145970	`PF01863`	YgjP-like	89	176	0.43	11.3
TkA07G145970	`PF16378`	DUF4988	91	120	0.12	12.7
TkA07G145970	`PF07558`	Shugoshin_N	122	136	0.029	14.9
TkA07G145970	`PF16559`	GIT_CC	124	154	0.4	11.1
TkA07G145970	`PF01863`	YgjP-like	130	217	0.43	11.3
TkA07G145970	`PF25481`	Nucleoprot-TPR	154	187	0.0093	16.7
TkA07G145970	`PF30835`	CEP83_CC_2nd	158	236	2.8	7.8
TkA07G145970	`PF11559`	ADIP	206	248	1.2e-48	165.8
TkA07G145970	`PF16559`	GIT_CC	216	255	0.4	11.1
TkA07G145970	`PF07558`	Shugoshin_N	221	239	0.029	14.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card