Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1143 bp · LXL04_028356|LXL04_028356|OH1004|cDNA
ATGGAATCAACTGACACTACGAACTTCGATCTCAGATCCAGCTTCGGAGCGAGTGAATACACATTTGCCGATGTTGAAAATTTGGATCATTGTGCCAAGTATTTGAACCAGACTTTAGTCACATTTGGATTTCCAGCTTCTCTGGATCTGTTTGCAACTGATCCGGTTTCAATTGCGAGGACTTGCAATTGCTTATACTCACTGTTGCAGCAAAGGCAACGTGATATTGAATTTCGAGAATCTACCAATGATCAGAGACA...
1143 bp · LXL04_028356|LXL04_028356|OH1004|CDS
ATGGAATCAACTGACACTACGAACTTCGATCTCAGATCCAGCTTCGGAGCGAGTGAATACACATTTGCCGATGTTGAAAATTTGGATCATTGTGCCAAGTATTTGAACCAGACTTTAGTCACATTTGGATTTCCAGCTTCTCTGGATCTGTTTGCAACTGATCCGGTTTCAATTGCGAGGACTTGCAATTGCTTATACTCACTGTTGCAGCAAAGGCAACGTGATATTGAATTTCGAGAATCTACCAATGATCAGAGACA...
Protein
Download Protein FASTA380 aa · LXL04_028356|LXL04_028356|OH1004|PROTEIN
MESTDTTNFDLRSSFGASEYTFADVENLDHCAKYLNQTLVTFGFPASLDLFATDPVSIARTCNCLYSLLQQRQRDIEFRESTNDQRQRLSSDISRLEAKVERLEAQLSAKDREIATITRTEAKAKAGLKAQIDKLQQERDEFQRMVIGNQQVKTQQIHEMKKKEKEYIKLQERLNQVMMEKKKESRSGMEIMNLLQKEGRQRGTWNGKKADNDFYKKIVDAYEAKNQELVAENADLRALLRSMQVDMREFLNAPNGSSKH...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_028356 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_028356 |
|---|---|
| Location | Chr06:38861776-38864453 (+) |
| Description | Similar to Ssx2ip: Afadin- and alpha-actinin-binding protein |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0007098 centrosome cycle Biological Process GO:0007155 cell adhesion Biological Process GO:0030036 actin cytoskeleton organization Biological Process GO:0035020 regulation of Rac protein signal transduction Biological Process GO:0035735 intraciliary transport involved in cilium assembly Biological Process GO:0060271 cilium assembly Biological Process GO:2000145 regulation of cell motility Biological Process GO:0001669 acrosomal vesicle Cellular Component GO:0005634 nucleus Cellular Component GO:0005813 centrosome Cellular Component GO:0005874 microtubule Cellular Component GO:0005912 adherens junction Cellular Component |
| KEGG gene cross-reference | hsa:117178 mmu:99167 rno:308023 xla:431833 xla:431921 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF11559.14ADIP30-176 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_028356 | PF11559.14 | ADIP | 30 | 176 | 1.2e-48 | 165.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.