TkA07G140530 | RubberDandelionOmics

Gene overview

TkA07G140530

Reference: TK1151 Chr: Chr07 Coordinates: 36312177-36315776 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3412 bp · TkA07G140530|TK1151|cDNA

TTACTATCACCCATCTTTCATGTCTATAGTGAGAACCCAAAGAATAATGAATCTTGTTTCTTCTTTTCTTTTCACACACCTTTTTTGATTTAAGCCGTGTCTTCCTTTCAAGATTCCGATATATGGTTGTTGGTCGGCCTTTTGTATTCAATTTGATTAGACCCTTCGATTTCTCAGCATTTTGTAGAAATTCAAGTTCTGGGCATTTTTAGTTTCTGATTTCAGACGAAACCCAGTTCGATTACTCACCAATTTTGATT...

CDS

Download CDS FASTA

2934 bp · TkA07G140530|TK1151|CDS

ATGAGGGCAGGGTTGAGTACGATCCTTCAGACCTTAACGCCGGAAGCGGCGAGTGTTTTGAATCATTCAATAGCGGAAGCCGGCCGTCGAAATCACAACCAAACGACGCCGCTCCATGTGGCAGCAACGCTTCTGTCCGCTCCGACGGGGTTCCTCCGGCAAGCTTGCATACGGTCTCACCCGAATTCCTCACACCCTCTTCAGTGCCGGGCACTCGAGCTCTGTTTCAGCGTAGCGTTAGAGCGGCTACCTTCAGCTAC...

Protein

Download Protein FASTA

977 aa · TkA07G140530|TK1151|PROTEIN

MRAGLSTILQTLTPEAASVLNHSIAEAGRRNHNQTTPLHVAATLLSAPTGFLRQACIRSHPNSSHPLQCRALELCFSVALERLPSATSSPAVTEPPVSNALMAALKRAQAHQRRGCPEQQQQPLLAVKVELEQLIISILDDPSVSRVMREASFSSPAVKATIEQSLNSSNVSGIGFRPTPSPTTPVPIPINRNLYINPRLQRNDDTAVSSSSTNIYLNPRLQQQHGNYSFSQSGHQRIDDAKRVMEIMSKSKKKNPILVG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G140530`
TK1151 ID	TkA07G140530
OH-1004 ID	LXL04_028301
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G140530

Location Chr07:36312177-36315776 (-)

Description Similar to SMAX1: Protein SUPPRESSOR OF MAX2 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g57710`	Probable component of a transcriptional corepressor complex that acts downstream of MAX2 to negatively regulate karrikins/strigolactone responses.	SUPPRESSOR OF MORE AXILLARY GROWTH2 1 controls seed germination and seedling development in Arabidopsis.2013 · DOI: 10.1104/pp.113.221259 SMAX1-LIKE/D53 Family Members Enable Distinct MAX2-Dependent Responses to Strigolactones and Karrikins in Arabidopsis.2015 · DOI: 10.1105/tpc.15.00562 Functional redundancy in the control of seedling growth by the karrikin signaling pathway.2016 · DOI: 10.1007/s00425-015-2458-2
`At4g30350`	Probable component of a transcriptional corepressor complex that acts specifically in the karrikin pathway.	Functional redundancy in the control of seedling growth by the karrikin signaling pathway.2016 · DOI: 10.1007/s00425-015-2458-2
`At3g52490`	May function in a transcriptional corepressor complex.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0250900`	May act downstream of MAX2 to negatively regulate karrikins/strigolactone responses.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028301 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009845 seed germination Biological Process

GO:0080167 response to karrikin Biological Process

GO:0090351 seedling development Biological Process

GO:1902347 response to strigolactone Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0044183 protein folding chaperone Molecular Function

KEGG gene cross-reference

ath:AT3G52490

ath:AT4G30350

ath:AT5G57710

dosa:Os08g0250900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.859

Rank 1 · TkA07G140530 · TK1151

Cytoplasm0.152

Rank 2 · TkA07G140530 · TK1151

Cell membrane0.056

Rank 3 · TkA07G140530 · TK1151

Endoplasmic reticulum0.041

Rank 4 · TkA07G140530 · TK1151

Plastid0.035

Rank 5 · TkA07G140530 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02861Clp_N12-113 aa

PF18953SAP_new25106-113 aa

PF02861Clp_N129-171 aa

PF15186TEX13130-154 aa

PF02861Clp_N219-248 aa

PF23569NBD_SMAX1237-412 aa

PF23569NBD_SMAX1694-739 aa

PF07724AAA_2700-785 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G140530	`PF02861`	Clp_N	12	113	2.7e-09	38.0
TkA07G140530	`PF18953`	SAP_new25	106	113	0.98	9.8
TkA07G140530	`PF02861`	Clp_N	129	171	2.7e-09	38.0
TkA07G140530	`PF15186`	TEX13	130	154	0.11	13.0
TkA07G140530	`PF02861`	Clp_N	219	248	2.7e-09	38.0
TkA07G140530	`PF23569`	NBD_SMAX1	237	412	3.4e-28	99.6
TkA07G140530	`PF23569`	NBD_SMAX1	694	739	3.4e-28	99.6
TkA07G140530	`PF07724`	AAA_2	700	785	5.3e-11	43.5
TkA07G140530	`PF26587`	AAA_lid_SMAX1	876	955	1.8e-19	70.0
TkA07G140530	`PF15186`	TEX13	917	970	0.11	13.0
TkA07G140530	`PF18953`	SAP_new25	920	952	0.98	9.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FHH2`	Arabidopsis thaliana	sp\|Q9FHH2\|SMAX1_ARATH Protein SUPPRESSOR OF MAX2 1	46.600%	Swiss-Prot	Medium
`Q9M0C5`	Arabidopsis thaliana	sp\|Q9M0C5\|SMXL2_ARATH Protein SMAX1-LIKE 2	44.400%	Swiss-Prot	Medium
`Q9SVD0`	Arabidopsis thaliana	sp\|Q9SVD0\|SMXL3_ARATH Protein SMAX1-LIKE 3	31.800%	Swiss-Prot	Medium
`Q6Z517`	Oryza sativa subsp. japonica	sp\|Q6Z517\|SMAX1_ORYSJ Protein SMAX1-like	38.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card