TkA07G129740 | RubberDandelionOmics

Gene overview

TkA07G129740

Reference: TK1151 Chr: Chr07 Coordinates: 33549236-33551630 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

733 bp · TkA07G129740|TK1151|cDNA

ACAAAACCTCAATTAATACTCTATACCTGTTCTTCGTCCATCAATCTAGCTACCTGTACTGAATATGCCAACATCATCAAACCTTGCACTTGATGATTCATCAATCCCTCAACCTGAGCCACCTACCTATACATCAGATAGCTTTCTACATGCTTCAAATGCTAATGTCTGTAACTATGTTTCAATGAAGGTGTCTAATAACCACAGCTACCGTCTTTGGAAGAGACAAATTCTTTGCCTACTGAATATTCACAATATGG...

CDS

Download CDS FASTA

669 bp · TkA07G129740|TK1151|CDS

ATGCCAACATCATCAAACCTTGCACTTGATGATTCATCAATCCCTCAACCTGAGCCACCTACCTATACATCAGATAGCTTTCTACATGCTTCAAATGCTAATGTCTGTAACTATGTTTCAATGAAGGTGTCTAATAACCACAGCTACCGTCTTTGGAAGAGACAAATTCTTTGCCTACTGAATATTCACAATATGGTTGCCCTCGTGGATGAGACAATGGACCGTCCCACAGCTTCAACCAATGAGATCATGACCAAATA...

Protein

Download Protein FASTA

223 aa · TkA07G129740|TK1151|PROTEIN

MPTSSNLALDDSSIPQPEPPTYTSDSFLHASNANVCNYVSMKVSNNHSYRLWKRQILCLLNIHNMVALVDETMDRPTASTNEIMTKYDSLLKGWIFGSISEALLTQVIDFGSAKDVWDKLILIYGPTMSSEIVKLSGPNYHIWKTQMLLLMKNYKIDGLVDHTIDGPMVSSKATLDTHERLLKSWIVDSVSNDLLLDNIHLRSAKDIWDYLKWNYDSTLTSEI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G129740`
TK1151 ID	TkA07G129740
OH-1004 ID	LXL04_028204
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	94.600
Protein coverage (%)	TK1151 100.000 / OH-1004 22.802 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G129740`
Location	Chr07:33549236-33551630 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_028204` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0007219 Notch signaling pathway Biological Process GO:0009651 response to salt stress Biological Process GO:0010803 regulation of tumor necrosis factor-mediated signaling pathway Biological Process GO:0016567 protein ubiquitination Biological Process GO:0000139 Golgi membrane Cellular Component GO:0000151 ubiquitin ligase complex Cellular Component GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005769 early endosome Cellular Component GO:0005829 cytosol Cellular Component GO:0005886 plasma membrane Cellular Component GO:0003779 actin binding Molecular Function
KEGG gene cross-reference	ath:AT3G12360 hsa:142678 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.678

Rank 1 · TkA07G129740 · TK1151

Nucleus0.219

Rank 2 · TkA07G129740 · TK1151

Cell membrane0.076

Rank 3 · TkA07G129740 · TK1151

Endoplasmic reticulum0.072

Rank 4 · TkA07G129740 · TK1151

Extracellular0.060

Rank 5 · TkA07G129740 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14244Retrotran_gag_345-76 aa

PF13961DUF421949-60 aa

PF14223Retrotran_gag_260-125 aa

PF13961DUF4219113-118 aa

PF14244Retrotran_gag_3133-161 aa

PF13961DUF4219135-152 aa

PF14223Retrotran_gag_2150-218 aa

PF13961DUF4219204-210 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G129740	`PF14244`	Retrotran_gag_3	45	76	0.00016	22.1
TkA07G129740	`PF13961`	DUF4219	49	60	0.094	13.2
TkA07G129740	`PF14223`	Retrotran_gag_2	60	125	3.8e-14	53.5
TkA07G129740	`PF13961`	DUF4219	113	118	0.094	13.2
TkA07G129740	`PF14244`	Retrotran_gag_3	133	161	0.00016	22.1
TkA07G129740	`PF13961`	DUF4219	135	152	0.094	13.2
TkA07G129740	`PF14223`	Retrotran_gag_2	150	218	3.8e-14	53.5
TkA07G129740	`PF13961`	DUF4219	204	210	0.094	13.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card