Gene Card
Gene overview
cDNA / CDS / Protein Sequences
4135 bp · TkA07G111630|TK1151|cDNA
CTGGTTCTCTTTGGCCCATCTACCCCAACCGAGTTGGCGAGATCGTCAGGCAATTTTTGTTCGAGCCGAGTCACGACTCAAAGGGCGAATTCAGTCGGAAATCACTTCGGGACTGTGAATTCATAAAAAAGGCGCCAAATTTCCCCCCTCTAAATACTTCCACTTCTATTCTCAGAAAACTCATCTCTTTCGAACGACCAAACGATGCAGCGCCAGAAGTCTATGCTATCGTTTTTTCAGAAAGCTCCGACGGTGCCGAA...
3591 bp · TkA07G111630|TK1151|CDS
ATGCAGCGCCAGAAGTCTATGCTATCGTTTTTTCAGAAAGCTCCGACGGTGCCGAAAACTGAAAAATCGGTCGGCGGTGAAGCTCTCAAAGGCGACTCTGAGGCGAAGATACATCGAAGAAATATACCTGCATCCAACCAGCCTACTATTCTCTCATCTGCACTGGAAATCAATAATGAAATCATTGGAACTGAGACTCCGCCTGAGAAGGAACAACGTCCATTTTTTCCGTCCAAGTCGTTTGGCGGCGGTGAAAACGA...
Protein
Download Protein FASTA1196 aa · TkA07G111630|TK1151|PROTEIN
MQRQKSMLSFFQKAPTVPKTEKSVGGEALKGDSEAKIHRRNIPASNQPTILSSALEINNEIIGTETPPEKEQRPFFPSKSFGGGENDEANSSGHLSFSSIKHKFVKPNSVEKPCDRNLSDNICDNVFSISNDSNRREKEGSVSAFSRMKNVSEVERIACQGDKGYPLIIEGDSDITEPQTPATRPLIPRMKRIQEDSCTFGSTTTSDSSINNFGNLNFSQDSPAKNKKNEVPSEMPMNNSKRVQFSQDLLSENKKDEVAS...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA07G111630 |
|---|---|
| TK1151 ID | TkA07G111630 |
| OH-1004 ID | LXL04_027997 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 95.444Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA07G111630 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr07:28911896-28917999 (+) | |||||||||
| Description | Similar to MSH7: DNA mismatch repair protein MSH7 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006298 mismatch repair Biological Process GO:0043570 maintenance of DNA repeat elements Biological Process GO:0005634 nucleus Cellular Component GO:0005829 cytosol Cellular Component GO:0032301 MutSalpha complex Cellular Component GO:0003684 damaged DNA binding Molecular Function GO:0005524 ATP binding Molecular Function GO:0016887 ATP hydrolysis activity Molecular Function GO:0030983 mismatched DNA binding Molecular Function GO:0032137 guanine/thymine mispair binding Molecular Function GO:0140664 ATP-dependent DNA damage sensor activity Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT3G24495 cph:Cpha266_1896 ppd:Ppro_1064 spo:2539215 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF08976EF-hand_11249-287 aaPF08976EF-hand_11276-316 aaPF01624MutS_I359-469 aaPF05188MutS_II479-627 aaPF05192MutS_III647-865 aaPF13555AAA_29931-952 aaPF00488MutS_V936-1126 aaPF08976EF-hand_111038-1063 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA07G111630 | PF08976 | EF-hand_11 | 249 | 287 | 0.34 | 12.5 |
| TkA07G111630 | PF08976 | EF-hand_11 | 276 | 316 | 0.34 | 12.5 |
| TkA07G111630 | PF01624 | MutS_I | 359 | 469 | 8.2e-30 | 104.1 |
| TkA07G111630 | PF05188 | MutS_II | 479 | 627 | 2.5e-11 | 44.8 |
| TkA07G111630 | PF05192 | MutS_III | 647 | 865 | 2.9e-33 | 116.5 |
| TkA07G111630 | PF13555 | AAA_29 | 931 | 952 | 0.12 | 12.9 |
| TkA07G111630 | PF00488 | MutS_V | 936 | 1126 | 1.8e-73 | 247.2 |
| TkA07G111630 | PF08976 | EF-hand_11 | 1038 | 1063 | 0.34 | 12.5 |
| TkA07G111630 | PF01624 | MutS_I | 1108 | 1122 | 8.2e-30 | 104.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.