LXL04_027997 | RubberDandelionOmics

Gene overview

LXL04_027997

Reference: OH-1004 Chr: Chr06 Coordinates: 28389261-28397299 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3756 bp · LXL04_027997|LXL04_027997|OH1004|cDNA

ATGCAGCGCCAGAAGTCTATGCTATCGTTTTTTCAGAAAGCTCCGACGGTGCCGAAAACTGAAAAATCGGTCGGCGGTGAAGCTCTCAAAGGCGACTCTGAGGCGAAGATACATCGAAGAAATATACCTGCATCCAACCAGCCTACTATTCTCTCATCTGCACTGGAAATCAATAATGAAATCATTGGAACTGAGACTCCGCCTGAGAAGGAACAACGTCCATTTTTTCCGTCAAAGTCGTTTGGCGGCGGTGAAAACGA...

CDS

Download CDS FASTA

3756 bp · LXL04_027997|LXL04_027997|OH1004|CDS

ATGCAGCGCCAGAAGTCTATGCTATCGTTTTTTCAGAAAGCTCCGACGGTGCCGAAAACTGAAAAATCGGTCGGCGGTGAAGCTCTCAAAGGCGACTCTGAGGCGAAGATACATCGAAGAAATATACCTGCATCCAACCAGCCTACTATTCTCTCATCTGCACTGGAAATCAATAATGAAATCATTGGAACTGAGACTCCGCCTGAGAAGGAACAACGTCCATTTTTTCCGTCAAAGTCGTTTGGCGGCGGTGAAAACGA...

Protein

Download Protein FASTA

1251 aa · LXL04_027997|LXL04_027997|OH1004|PROTEIN

MQRQKSMLSFFQKAPTVPKTEKSVGGEALKGDSEAKIHRRNIPASNQPTILSSALEINNEIIGTETPPEKEQRPFFPSKSFGGGENDEANRSGHLSFSSIKHKFVKPNSVEKPWDRNLSDNICDNVFSISNDSNRREKEGSVSAFSRMKNVSEVERTACQGDKGHPLIIEGDSDITEPQTPATRPLIPRMKRIQEDSCTFGSTTTSDSSINNFGNLNFSQDSPAKNKKNEVPFEMPMNNSKRVQFSQDLLSENKKDEVAS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027997`
TK1151 ID	TkA07G111630
OH-1004 ID	LXL04_027997
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 95.444 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027997

Location Chr06:28389261-28397299 (+)

Description Similar to MSH7: DNA mismatch repair protein MSH7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g24495`	Component of the post-replicative DNA mismatch repair system (MMR).	Arabidopsis MutS homologs-AtMSH2, AtMSH3, AtMSH6, and a novel AtMSH7-form three distinct protein heterodimers with different specificities for mismatched DNA.2000 · DOI: 10.1105/tpc.12.6.991 Dissimilar mispair-recognition spectra of Arabidopsis DNA-mismatch-repair proteins MSH2MSH6 (MutSalpha) and MSH2MSH7 (MutSgamma).2003 · DOI: 10.1093/nar/gkg780

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027997 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006298 mismatch repair Biological Process

GO:0043570 maintenance of DNA repeat elements Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0032301 MutSalpha complex Cellular Component

GO:0003684 damaged DNA binding Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0030983 mismatched DNA binding Molecular Function

GO:0032137 guanine/thymine mispair binding Molecular Function

GO:0140664 ATP-dependent DNA damage sensor activity Molecular Function

KEGG gene cross-reference

ath:AT3G24495

cph:Cpha266_1896

ppd:Ppro_1064

spo:2539215

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.904

Rank 1 · LXL04_027997 · OH-1004

Cytoplasm0.132

Rank 2 · LXL04_027997 · OH-1004

Mitochondrion0.030

Rank 3 · LXL04_027997 · OH-1004

Cell membrane0.022

Rank 4 · LXL04_027997 · OH-1004

Plastid0.018

Rank 5 · LXL04_027997 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01624.26MutS_I359-469 aa

PF05188.24MutS_II479-625 aa

PF05192.24MutS_III645-863 aa

PF00488.28MutS_V934-1124 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027997	`PF01624.26`	MutS_I	359	469	8.7e-30	104.0
LXL04_027997	`PF05188.24`	MutS_II	479	625	5e-10	40.7
LXL04_027997	`PF05192.24`	MutS_III	645	863	3.3e-33	116.4
LXL04_027997	`PF00488.28`	MutS_V	934	1124	1.4e-73	247.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SMV7`	Arabidopsis thaliana	DNA mismatch repair protein MSH7	63.916%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card