TkA07G110480 | RubberDandelionOmics

Gene overview

TkA07G110480

Reference: TK1151 Chr: Chr07 Coordinates: 28605500-28609687 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1979 bp · TkA07G110480|TK1151|cDNA

TTTGAAGTATCAGGTGGTGTGGAACTGTGGATAACAAAGTAGCGTTGCGCGCGTGTAGGACAAGTGCTCAGCGTATTAAAGCCACAACCGCCTTCATACTCGTACAATATACGCTGCTGTGCCGAAATTTGGCGAAGAACCTTGTCGACTTCCGATTCGAATTTCAGTTTTCTCCGGTTCTTTCAAGAATCAGAACAAATCGTTAGTGATCTTAGGGTTCTCCAAGTTGTGCAATCCGGAATCAAGTCTGGACAGATTCT...

CDS

Download CDS FASTA

1470 bp · TkA07G110480|TK1151|CDS

ATGCGGGTACATCCACACGGTTCTGCCTCCATGTATAAACGGATGCCTTCTAAGGACTATACAAATTCAGTTGAACTAGAAGATGGTTCTGAACCTTTGCAGGATGATATGGTCCAAGAATCTACAAATCCATCTCCAAGACATTCTCTACCTCATGTACTTGTGGCATCCTTAGTCTCTTTCCTATTTGGCTACCATCTCGGGGTAGTGAATGAACCGCTTGAAAGCATATCTCATGATCTTGGTTTCAGTGGTGATAG...

Protein

Download Protein FASTA

489 aa · TkA07G110480|TK1151|PROTEIN

MRVHPHGSASMYKRMPSKDYTNSVELEDGSEPLQDDMVQESTNPSPRHSLPHVLVASLVSFLFGYHLGVVNEPLESISHDLGFSGDSLAEGLVVSTCLGGAFLGSLFSGLIADGVGRRRAFQLCALPMIIGASCSATTNNLTGMLVGRFIVGIGLGIGPPVASLYITEVSPPAVRGTYGSFIQISTCLGLMGALLIGIPVKTVPGWWRICFWLSTIPSTILALAMIFCAESPHWLYKRGRNAEAEVEFQKLLGAANVRPA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G110480`
TK1151 ID	TkA07G110480
OH-1004 ID	LXL04_027977
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.500
Protein coverage (%)	TK1151 100.000 / OH-1004 96.198 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G110480

Location Chr07:28605500-28609687 (-)

Description Similar to At1g67300: Probable plastidic glucose transporter 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g67300`	May be involved in the efflux of glucose towards the cytosol.	No verified direct reference in this release
`At1g79820`	May be involved in the efflux of glucose towards the cytosol.	No verified direct reference in this release
`At1g05030`	May be involved in the efflux of glucose towards the cytosol.	No verified direct reference in this release
`At5g16150`	May be involved in the efflux of glucose towards the cytosol.	No verified direct reference in this release
`At1g19450`	Sugar transporter.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027977 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0008643 carbohydrate transport Biological Process

GO:0010030 positive regulation of seed germination Biological Process

GO:0015749 monosaccharide transmembrane transport Biological Process

GO:0042593 glucose homeostasis Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005802 trans-Golgi network Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G05030

ath:AT1G67300

ath:AT1G75220

ath:AT1G79820

ath:AT5G16150

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.454

Rank 1 · TkA07G110480 · TK1151

Cell membrane0.179

Rank 2 · TkA07G110480 · TK1151

Cytoplasm0.163

Rank 3 · TkA07G110480 · TK1151

Golgi apparatus0.152

Rank 4 · TkA07G110480 · TK1151

Endoplasmic reticulum0.125

Rank 5 · TkA07G110480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14715FixP_N35-47 aa

PF00083Sugar_tr53-483 aa

PF07690MFS_157-398 aa

PF14715FixP_N202-216 aa

PF14715FixP_N289-299 aa

PF07690MFS_1370-468 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G110480	`PF14715`	FixP_N	35	47	3.0	8.3
TkA07G110480	`PF00083`	Sugar_tr	53	483	1.5e-99	334.6
TkA07G110480	`PF07690`	MFS_1	57	398	2e-25	90.2
TkA07G110480	`PF14715`	FixP_N	202	216	3.0	8.3
TkA07G110480	`PF14715`	FixP_N	289	299	3.0	8.3
TkA07G110480	`PF07690`	MFS_1	370	468	2e-25	90.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FYG3`	Arabidopsis thaliana	sp\|Q9FYG3\|PLST2_ARATH Probable plastidic glucose transporter 2	71.200%	Swiss-Prot	High
`Q2V4B9`	Arabidopsis thaliana	sp\|Q2V4B9\|PLST3_ARATH Probable plastidic glucose transporter 3	66.500%	Swiss-Prot	High
`Q0WVE9`	Arabidopsis thaliana	sp\|Q0WVE9\|PLST1_ARATH Probable plastidic glucose transporter 1	45.300%	Swiss-Prot	Medium
`Q56ZZ7`	Arabidopsis thaliana	sp\|Q56ZZ7\|PLST4_ARATH Plastidic glucose transporter 4	44.900%	Swiss-Prot	Medium
`Q93YP9`	Arabidopsis thaliana	sp\|Q93YP9\|ERDL4_ARATH Sugar transporter ERD6-like 4	35.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card