TkA07G101520 | RubberDandelionOmics

Gene overview

TkA07G101520

Reference: TK1151 Chr: Chr07 Coordinates: 26400866-26408334 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2175 bp · TkA07G101520|TK1151|cDNA

ATGCCTATGGATTTCGAGGAAGAAGATGTGATTGTTGTAGCTTTCAGTTCAGTTACAGACCCGTTTCTGTCCAATATTTGTGAAGATGAAGGAGATGAAAGTACTGATGAAGACTTGGTCCATCTTGATGAAGACGAGAATGACATTGCTGGTCAGTTCTTGTTCATGATCCCACCAAAGAATGGAATGTCATGGAACCAAGTGACCCATGGGTACCCTTTGAGGTTTGAGAAGCTTGAAAGTACAAGGTTACTTGCTAA...

CDS

Download CDS FASTA

2175 bp · TkA07G101520|TK1151|CDS

ATGCCTATGGATTTCGAGGAAGAAGATGTGATTGTTGTAGCTTTCAGTTCAGTTACAGACCCGTTTCTGTCCAATATTTGTGAAGATGAAGGAGATGAAAGTACTGATGAAGACTTGGTCCATCTTGATGAAGACGAGAATGACATTGCTGGTCAGTTCTTGTTCATGATCCCACCAAAGAATGGAATGTCATGGAACCAAGTGACCCATGGGTACCCTTTGAGGTTTGAGAAGCTTGAAAGTACAAGGTTACTTGCTAA...

Protein

Download Protein FASTA

724 aa · TkA07G101520|TK1151|PROTEIN

MPMDFEEEDVIVVAFSSVTDPFLSNICEDEGDESTDEDLVHLDEDENDIAGQFLFMIPPKNGMSWNQVTHGYPLRFEKLESTRLLAKCGRDTNKKNYPFRLYASWMNTERTVQVIATPPSSFHPTHINITERDQDINESITQEEGFAIVIRVKTTFEVECLGFVSCSFDILAVTTTNLVIQVGDLHYEVKLGGRDGLESNCLRHRTVEACLVHIMLLLDAELLDRVFKAPITTVKSIPYSCRLAFSQALKNVLYKVIAQP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G101520`
TK1151 ID	TkA07G101520
OH-1004 ID	LXL04_008246
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	56.400
Protein coverage (%)	TK1151 52.210 / OH-1004 29.232 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G101520`
Location	Chr07:26400866-26408334 (+)
Description	Similar to SLC25A44: Solute carrier family 25 member 44
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_008246` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000027 ribosomal large subunit assembly Biological Process GO:0006865 amino acid transport Biological Process GO:0009083 branched-chain amino acid catabolic process Biological Process GO:0009553 embryo sac development Biological Process GO:0009738 abscisic acid-activated signaling pathway Biological Process GO:0015803 branched-chain amino acid transport Biological Process GO:0048638 regulation of developmental growth Biological Process GO:0055085 transmembrane transport Biological Process GO:0120161 regulation of cold-induced thermogenesis Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005730 nucleolus Cellular Component
KEGG gene cross-reference	ath:AT1G67120 ddi:DDB_G0280083 hsa:9673 mmu:229517 pon:100172017 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.496

Rank 1 · TkA07G101520 · TK1151

Nucleus0.437

Rank 2 · TkA07G101520 · TK1151

Mitochondrion0.067

Rank 3 · TkA07G101520 · TK1151

Plastid0.055

Rank 4 · TkA07G101520 · TK1151

Endoplasmic reticulum0.048

Rank 5 · TkA07G101520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00141peroxidase130-201 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G101520	`PF00141`	peroxidase	130	201	7.5e-06	26.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card