TkA07G083110 | RubberDandelionOmics

Gene overview

TkA07G083110

Reference: TK1151 Chr: Chr07 Coordinates: 21741522-21745260 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1487 bp · TkA07G083110|TK1151|cDNA

AGAATGCAAGCTTTTCTTTCCAAAAAGAGAAATATTTTAACAAAAATCTTGGTGGTGGAGTGGAAATAGCAAAAGTAGTGTCTGGAATACTCGGTCTGAGGAGGCGAATAGCGTCTTCCAGGGGAGGTGGTCGCGGCCGTCGTATGCCACTCTTATAAGCCCTACAGTTGTGCCCTTTCAGAGATCAGGACTCGGGAGAAGTAAAGAGAAGAAGATTTCTACTTCAACCTTCTCTCTCTTTCTCTCCCACCGTCTTCTCT...

CDS

Download CDS FASTA

1071 bp · TkA07G083110|TK1151|CDS

ATGGAAGGCGGTGGAGAAGAACTAATCATGCCAATCCATGATCCTGATGTCTCCCCCGTTGGTTCGCTGGAGGAAACGATCATGGATCCTCACTCCGAGAATCAGCCCCAGGAGTCCGATGATCATCCTCATCCTCCTCCTTCGGCCACCGATACCGCCACCCTAACGGATGAACTTCGGGACAAAATTATCAGACAGGTGGAGTACTATTTCAGTGATGAAAACTTGAGAACTGACAAGTTTTTGTTGAAATATCTTGG...

Protein

Download Protein FASTA

356 aa · TkA07G083110|TK1151|PROTEIN

MEGGGEELIMPIHDPDVSPVGSLEETIMDPHSENQPQESDDHPHPPPSATDTATLTDELRDKIIRQVEYYFSDENLRTDKFLLKYLGKEDEGYVPVAVIASFKKMKKLTHHKSLIVAALKESSLLTLSSSEKKVKRVHPFPLTEAFDPELCTVLVENLPEDHTIENMKKIFGQAGLIKKITIHEENAAREQRKCSIEEKLLSGKLHAVVEYDTVEAAENAVATLNNEQDWRHGMRVKLLKRKAKIAPRKKIHESEKKFNV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G083110`
TK1151 ID	TkA07G083110
OH-1004 ID	LXL04_027652
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	96.200
Protein coverage (%)	TK1151 100.000 / OH-1004 76.091 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G083110

Location Chr07:21741522-21745260 (-)

Description Similar to LARP6A: La-related protein 6A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g46250`	Transcriptional regulator.	No verified direct reference in this release
`At3g19090`	Transcriptional regulator.	No verified direct reference in this release
`At2g43970`	Transcriptional regulator.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027652 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006396 RNA processing Biological Process

GO:0006417 regulation of translation Biological Process

GO:0009846 pollen germination Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0032967 positive regulation of collagen biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:1990904 ribonucleoprotein complex Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G43970

ath:AT3G19090

ath:AT5G46250

hsa:55323

mmu:67557

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.518

Rank 1 · TkA07G083110 · TK1151

Cytoplasm0.516

Rank 2 · TkA07G083110 · TK1151

Cell membrane0.075

Rank 3 · TkA07G083110 · TK1151

Endoplasmic reticulum0.046

Rank 4 · TkA07G083110 · TK1151

Mitochondrion0.031

Rank 5 · TkA07G083110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21224Hen1_LCD60-129 aa

PF05383La63-121 aa

PF11020DUF261083-121 aa

PF26763Whi3-like_N97-115 aa

PF00076RRM_1153-190 aa

PF28976RRM_ACIN1153-180 aa

PF26763Whi3-like_N154-225 aa

PF11020DUF2610188-218 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G083110	`PF21224`	Hen1_LCD	60	129	0.11	13.8
TkA07G083110	`PF05383`	La	63	121	1.7e-25	89.3
TkA07G083110	`PF11020`	DUF2610	83	121	0.19	12.7
TkA07G083110	`PF26763`	Whi3-like_N	97	115	0.079	14.0
TkA07G083110	`PF00076`	RRM_1	153	190	3.3e-08	34.0
TkA07G083110	`PF28976`	RRM_ACIN1	153	180	0.18	12.6
TkA07G083110	`PF26763`	Whi3-like_N	154	225	0.079	14.0
TkA07G083110	`PF11020`	DUF2610	188	218	0.19	12.7
TkA07G083110	`PF00076`	RRM_1	204	227	3.3e-08	34.0
TkA07G083110	`PF28976`	RRM_ACIN1	204	228	0.18	12.6
TkA07G083110	`PF05890`	Ebp2	235	307	0.011	16.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94A38`	Arabidopsis thaliana	sp\|Q94A38\|LRP6A_ARATH La-related protein 6A	49.600%	Swiss-Prot	Medium
`Q9LHL3`	Arabidopsis thaliana	sp\|Q9LHL3\|LRP6C_ARATH La-related protein 6C	34.800%	Swiss-Prot	Medium
`O80567`	Arabidopsis thaliana	sp\|O80567\|LRP6B_ARATH La-related protein 6B	33.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card