LXL04_027652 | RubberDandelionOmics

Gene overview

LXL04_027652

Reference: OH-1004 Chr: Chr06 Coordinates: 21049407-21053245 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1446 bp · LXL04_027652|LXL04_027652|OH1004|cDNA

ATGCTGTTGTTATCTCTTCGGGGAGGGTTTGAACCCGGGTCGTTGAGTGTTATGGCATACTGCCATATCGGATGTCACTGTCCACTACACCAAACCGCCGAGAATGCAAACTTTTCTTTCCAAAAAGAGAAATATTTTAACAAAAATCTTGGTGGTGGAGTGGAAATAGCAAAAGTAGTGTCTGGAATACTCGGTCTGAGGAGGCGAATAGCGTCTTCCAGGGGAGGTGGTCGCGGCCGTCTTGTGCCCTTTCAGAGATC...

CDS

Download CDS FASTA

1446 bp · LXL04_027652|LXL04_027652|OH1004|CDS

ATGCTGTTGTTATCTCTTCGGGGAGGGTTTGAACCCGGGTCGTTGAGTGTTATGGCATACTGCCATATCGGATGTCACTGTCCACTACACCAAACCGCCGAGAATGCAAACTTTTCTTTCCAAAAAGAGAAATATTTTAACAAAAATCTTGGTGGTGGAGTGGAAATAGCAAAAGTAGTGTCTGGAATACTCGGTCTGAGGAGGCGAATAGCGTCTTCCAGGGGAGGTGGTCGCGGCCGTCTTGTGCCCTTTCAGAGATC...

Protein

Download Protein FASTA

481 aa · LXL04_027652|LXL04_027652|OH1004|PROTEIN

MLLLSLRGGFEPGSLSVMAYCHIGCHCPLHQTAENANFSFQKEKYFNKNLGGGVEIAKVVSGILGLRRRIASSRGGGRGRLVPFQRSGLGRSKEKKISTSTFSLFLSHRLLSSLRMEGGGEELIMPIHDPDVSPVGSLEETIMDPHSENQPQESDDHPHPPPSATDTATLTDELRDKIIRQVEYYFSDENLRTDKFLLKYLAKEDEGYVPVAVIASFKKMKKLTHHKSLIVAALKESSLLTLSSNEKKVKRVHPFPLTEA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027652`
TK1151 ID	TkA07G083110
OH-1004 ID	LXL04_027652
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	96.200
Protein coverage (%)	TK1151 100.000 / OH-1004 76.091 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027652

Location Chr06:21049407-21053245 (-)

Description Similar to LARP6A: La-related protein 6A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g46250`	Transcriptional regulator.	No verified direct reference in this release
`At3g19090`	Transcriptional regulator.	No verified direct reference in this release
`At2g43970`	Transcriptional regulator.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027652 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006396 RNA processing Biological Process

GO:0006417 regulation of translation Biological Process

GO:0009846 pollen germination Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0032967 positive regulation of collagen biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:1990904 ribonucleoprotein complex Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G43970

ath:AT3G19090

ath:AT5G46250

hsa:55323

mmu:67557

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.524

Rank 1 · LXL04_027652 · OH-1004

Cytoplasm0.436

Rank 2 · LXL04_027652 · OH-1004

Cell membrane0.082

Rank 3 · LXL04_027652 · OH-1004

Endoplasmic reticulum0.061

Rank 4 · LXL04_027652 · OH-1004

Mitochondrion0.048

Rank 5 · LXL04_027652 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05383.24La178-236 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027652	`PF05383.24`	La	178	236	2.6e-25	88.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94A38`	Arabidopsis thaliana	La-related protein 6A	48.189%	Swiss-Prot	moderate database homology
`Q9LHL3`	Arabidopsis thaliana	La-related protein 6C	35.522%	Swiss-Prot	moderate database homology
`O80567`	Arabidopsis thaliana	La-related protein 6B	35.688%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card