TkA07G080790 | RubberDandelionOmics

Gene overview

TkA07G080790

Reference: TK1151 Chr: Chr07 Coordinates: 21115704-21118828 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2164 bp · TkA07G080790|TK1151|cDNA

AATTAACACACACCACACCAAATGGTTCTCAGTTGTGTGTGAGTGGGCAGGGGAACCAATGAAGGGCTCTAATCTTCTACGTGCTCCAGTCTCTCTCTCAACTTCACTTCCGCTATATTCTCCACTCAAATTCGTAGCCTCCTTCAGAAATCCCATATGTTTCAATCACCTAATCCTAAGTTCTTTGAAGCTTCACCCAATTCGCATCTCTTGTGTGCACGCTACTGCTACTCAAGAGACTGTGGAAGTTAGTAAAAATG...

CDS

Download CDS FASTA

1905 bp · TkA07G080790|TK1151|CDS

ATGAAGGGCTCTAATCTTCTACGTGCTCCAGTCTCTCTCTCAACTTCACTTCCGCTATATTCTCCACTCAAATTCGTAGCCTCCTTCAGAAATCCCATATGTTTCAATCACCTAATCCTAAGTTCTTTGAAGCTTCACCCAATTCGCATCTCTTGTGTGCACGCTACTGCTACTCAAGAGACTGTGGAAGTTAGTAAAAATGATTCTCAATTTGTTGAGATTGGGTACATATCTAGTGTCCATGGACTACAAGGAGAGGT...

Protein

Download Protein FASTA

634 aa · TkA07G080790|TK1151|PROTEIN

MKGSNLLRAPVSLSTSLPLYSPLKFVASFRNPICFNHLILSSLKLHPIRISCVHATATQETVEVSKNDSQFVEIGYISSVHGLQGEVRVKPNTDFPELRFSEPGRRWLKRQILGKEIVEEVELIEGRGHHGQKSWIIKFNNIEKVEQAQQLVGSTILVLDEDRPELEEGDFYARDLVGMKVTLKESGEPVGTVVNVFDNGGSDLLQVKLSSSLDIIDKNGNMKSEAPLVWVPFVEAIVPHVDMNKREMIITPPKGLLELN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G080790`
TK1151 ID	TkA07G080790
OH-1004 ID	LXL04_027632
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.800
Protein coverage (%)	TK1151 98.738 / OH-1004 98.438 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G080790`
Location	Chr07:21115704-21118828 (-)
Description	Similar to rimM: Ribosome maturation factor RimM (Synechococcus sp. (strain RCC307)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_027632` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006364 rRNA processing Biological Process GO:0042274 ribosomal small subunit biogenesis Biological Process GO:0005737 cytoplasm Cellular Component GO:0005840 ribosome Cellular Component GO:0043022 ribosome binding Molecular Function
KEGG gene cross-reference	npu:Npun_F1948 pmf:P9303_26021 pmt:PMT_1951 syr:SynRCC307_0135 syx:SynWH7803_0201 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.940

Rank 1 · TkA07G080790 · TK1151

Mitochondrion0.060

Rank 2 · TkA07G080790 · TK1151

Cytoplasm0.045

Rank 3 · TkA07G080790 · TK1151

Nucleus0.042

Rank 4 · TkA07G080790 · TK1151

Peroxisome0.027

Rank 5 · TkA07G080790 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01247Ribosomal_L35Ae67-97 aa

PF01782RimM72-162 aa

PF01247Ribosomal_L35Ae132-159 aa

PF05239PRC169-257 aa

PF24986PRC_RimM175-256 aa

PF01782RimM252-298 aa

PF01704UDPGP380-523 aa

PF24986PRC_RimM394-405 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G080790	`PF01247`	Ribosomal_L35Ae	67	97	0.16	12.8
TkA07G080790	`PF01782`	RimM	72	162	7.1e-22	78.2
TkA07G080790	`PF01247`	Ribosomal_L35Ae	132	159	0.16	12.8
TkA07G080790	`PF05239`	PRC	169	257	4.2e-10	40.2
TkA07G080790	`PF24986`	PRC_RimM	175	256	6.7e-11	42.4
TkA07G080790	`PF01782`	RimM	252	298	7.1e-22	78.2
TkA07G080790	`PF01704`	UDPGP	380	523	0.0073	15.8
TkA07G080790	`PF24986`	PRC_RimM	394	405	6.7e-11	42.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card