TkA07G057870 | RubberDandelionOmics

Gene overview

TkA07G057870

Reference: TK1151 Chr: Chr07 Coordinates: 15358169-15358618 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

450 bp · TkA07G057870|TK1151|cDNA

ATGTCAATCGACGACCTTCTGAAATCAACAAACTGTTTCGATCAATCCAACATAATCGGGTGCGGAGGCTTCGGTCTCGTCTTCAAAGCCACACTTCCCGACGACGGGAAAGTCGCAATTAAACGTCTCTCCGGCGACGGCGGTCAAGTCGACCGGGAATTTCAAGCGGAAGTGGAAACCCTATCTAGGGCACAACATCCAAATCTCGTCCTCCTTCAAGGCTACTGCAAACACAAAAACGAAAGACTCCTCATATACTC...

CDS

Download CDS FASTA

450 bp · TkA07G057870|TK1151|CDS

ATGTCAATCGACGACCTTCTGAAATCAACAAACTGTTTCGATCAATCCAACATAATCGGGTGCGGAGGCTTCGGTCTCGTCTTCAAAGCCACACTTCCCGACGACGGGAAAGTCGCAATTAAACGTCTCTCCGGCGACGGCGGTCAAGTCGACCGGGAATTTCAAGCGGAAGTGGAAACCCTATCTAGGGCACAACATCCAAATCTCGTCCTCCTTCAAGGCTACTGCAAACACAAAAACGAAAGACTCCTCATATACTC...

Protein

Download Protein FASTA

149 aa · TkA07G057870|TK1151|PROTEIN

MSIDDLLKSTNCFDQSNIIGCGGFGLVFKATLPDDGKVAIKRLSGDGGQVDREFQAEVETLSRAQHPNLVLLQGYCKHKNERLLIYSFMENGSLECWLLHERPDGLSKLDWNTRQKIAQGAIRGLAYLHQSCDPHILHRDIKSSNILLD

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G057870`
TK1151 ID	TkA07G057870
OH-1004 ID	LXL04_025852
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	95.300
Protein coverage (%)	TK1151 100.000 / OH-1004 14.439 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G057870

Location Chr07:15358169-15358618 (-)

Description Similar to PSKR: Phytosulfokine receptor 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g02220`	Phytosulfokine receptor with both a serine/threonine-protein kinase activity and a guanylate cyclase activity.	Disruption and overexpression of Arabidopsis phytosulfokine receptor gene affects cellular longevity and potential for growth.2006 · DOI: 10.1104/pp.106.081109 The phytosulfokine (PSK) receptor is capable of guanylate cyclase activity and enabling cyclic GMP-dependent signaling in plants.2011 · DOI: 10.1074/jbc.m110.168823 The tyrosine-sulfated peptide receptors PSKR1 and PSY1R modify the immunity of Arabidopsis to biotrophic and necrotrophic pathogens in an antagonistic manner.2013 · DOI: 10.1111/tpj.12050
`At5g53890`	Phytosulfokine receptor with a serine/threonine-protein kinase activity.	No verified direct reference in this release
`At1g72300`	Tyrosine-sulfated glycopeptide receptor with a serine/threonine-protein kinase activity.	Tyrosine-sulfated glycopeptide involved in cellular proliferation and expansion in Arabidopsis.2007 · DOI: 10.1073/pnas.0706403104 The tyrosine-sulfated peptide receptors PSKR1 and PSY1R modify the immunity of Arabidopsis to biotrophic and necrotrophic pathogens in an antagonistic manner.2013 · DOI: 10.1111/tpj.12050 Receptor kinase-mediated control of primary active proton pumping at the plasma membrane.2014 · DOI: 10.1111/tpj.12680
`At4g39400`	Receptor with a dual specificity kinase activity acting on both serine/threonine- and tyrosine-containing substrates.	Brassinosteroid-insensitive dwarf mutants of Arabidopsis accumulate brassinosteroids.1999 · DOI: 10.1104/pp.121.3.743 Brassinosteroid-insensitive-1 is a ubiquitously expressed leucine-rich repeat receptor serine/threonine kinase.2000 · DOI: 10.1104/pp.123.4.1247 The Arabidopsis transthyretin-like protein is a potential substrate of BRASSINOSTEROID-INSENSITIVE 1.2004 · DOI: 10.1105/tpc.104.023903 The Arabidopsis thaliana brassinosteroid receptor (AtBRI1) contains a domain that functions as a guanylyl cyclase in vitro.2007 · DOI: 10.1371/journal.pone.0000449 BSKs mediate signal transduction from the receptor kinase BRI1 in Arabidopsis.2008 · DOI: 10.1126/science.1156973 Tyrosine phosphorylation of the BRI1 receptor kinase emerges as a component of brassinosteroid signaling in Arabidopsis.2009 · DOI: 10.1073/pnas.0810249106 BSKs are partially redundant positive regulators of brassinosteroid signaling in Arabidopsis.2013 · DOI: 10.1111/tpj.12175

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025852 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009729 detection of brassinosteroid stimulus Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0009755 hormone-mediated signaling pathway Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0031347 regulation of defense response Biological Process

GO:0045087 innate immune response Biological Process

GO:0045851 pH reduction Biological Process

KEGG gene cross-reference

ath:AT1G55610

ath:AT1G72300

ath:AT2G02220

ath:AT5G53890

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.553

Rank 1 · TkA07G057870 · TK1151

Cell membrane0.315

Rank 2 · TkA07G057870 · TK1151

Nucleus0.288

Rank 3 · TkA07G057870 · TK1151

Endoplasmic reticulum0.045

Rank 4 · TkA07G057870 · TK1151

Golgi apparatus0.043

Rank 5 · TkA07G057870 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase14-149 aa

PF17667Pkinase_fungal14-69 aa

PF07714PK_Tyr_Ser-Thr16-149 aa

PF03109ABC118-64 aa

PF00355Rieske54-98 aa

PF20748RecJ_C_Deinoc55-100 aa

PF03109ABC1114-148 aa

PF17667Pkinase_fungal119-148 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G057870	`PF00069`	Pkinase	14	149	3.7e-22	79.7
TkA07G057870	`PF17667`	Pkinase_fungal	14	69	0.14	11.6
TkA07G057870	`PF07714`	PK_Tyr_Ser-Thr	16	149	3.6e-21	76.4
TkA07G057870	`PF03109`	ABC1	18	64	0.009	15.9
TkA07G057870	`PF00355`	Rieske	54	98	0.15	12.7
TkA07G057870	`PF20748`	RecJ_C_Deinoc	55	100	0.23	11.9
TkA07G057870	`PF03109`	ABC1	114	148	0.009	15.9
TkA07G057870	`PF17667`	Pkinase_fungal	119	148	0.14	11.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZVR7`	Arabidopsis thaliana	sp\|Q9ZVR7\|PSKR1_ARATH Phytosulfokine receptor 1	75.800%	Swiss-Prot	High
`Q9FN37`	Arabidopsis thaliana	sp\|Q9FN37\|PSKR2_ARATH Phytosulfokine receptor 2	71.800%	Swiss-Prot	High
`Q9C7S5`	Arabidopsis thaliana	sp\|Q9C7S5\|PSYR1_ARATH Tyrosine-sulfated glycopeptide receptor 1	64.400%	Swiss-Prot	High
`O22476`	Arabidopsis thaliana	sp\|O22476\|BRI1_ARATH Protein BRASSINOSTEROID INSENSITIVE 1	55.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card