TkA07G053100 | RubberDandelionOmics

Gene overview

TkA07G053100

Reference: TK1151 Chr: Chr07 Coordinates: 14149957-14151434 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1368 bp · TkA07G053100|TK1151|cDNA

TTTCTAAAAGATAAAATAATTTATGACTGATCGGAATTTTGTTGCAGTTTCATTTTTGAAGAGGGAAAGAAAGCACGAGCGCTGTTTTCGCCATGGAAATGGTGGTGGAAGAACAAATCAACCTACAATTGCCCCACATCTGATAGAGTTTCTAGAATTGGTCGGAGAGGTGGAGGAAGATCGGATCAGTACGTTGCCAGATTGCTTGATTCTAGAAATCCTCTCTCGTCTACCCTCCACAAAAGGCGCCATTGTAACAG...

CDS

Download CDS FASTA

1119 bp · TkA07G053100|TK1151|CDS

ATGACTGATCGGAATTTTGTTGCAGTTTCATTTTTGAAGAGGGAAAGAAAGCACGAGCGCTGTTTTCGCCATGGAAATGGTGGTGGAAGAACAAATCAACCTACAATTGCCCCACATCTGATAGAGTTTCTAGAATTGGTCGGAGAGGTGGAGGAAGATCGGATCAGTACGTTGCCAGATTGCTTGATTCTAGAAATCCTCTCTCGTCTACCCTCCACAAAAGGCGCCATTGTAACAGGTACACTCTCCAAACGATGGAA...

Protein

Download Protein FASTA

372 aa · TkA07G053100|TK1151|PROTEIN

MTDRNFVAVSFLKRERKHERCFRHGNGGGRTNQPTIAPHLIEFLELVGEVEEDRISTLPDCLILEILSRLPSTKGAIVTGTLSKRWKSLWTLLPTLIFEHGESKAQKIHDFVSLVDQTLTQSRQLKLKKFVVYTYYDVRFESQVNSWIRYAIKRNVEELNLTLWNTEIKAEFLVDQSFFIGSCFTRLTLEGCIFNPIGAISWKNLKSLSISFGKLDEDLIENILSGSPVLETFELVACHGYRRLNITSKSIKNFVFSGYI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G053100`
TK1151 ID	TkA07G053100
OH-1004 ID	LXL04_027366
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 91.667 / OH-1004 15.068 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G053100

Location Chr07:14149957-14151434 (+)

Description Similar to At1g49610: Putative F-box protein At1g49610

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g18150`	Putative F-box/LRR-repeat protein At3g18150.	No verified direct reference in this release
`At5g02910`	F-box/LRR-repeat protein At5g02910.	No verified direct reference in this release
`At3g03360`	F-box/LRR-repeat protein At3g03360.	No verified direct reference in this release
`At3g28410`	Putative F-box/LRR-repeat protein At3g28410.	No verified direct reference in this release
`At5g02700`	Putative F-box/LRR-repeat protein At5g02700.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027366 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G49610

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.831

Rank 1 · TkA07G053100 · TK1151

Cytoplasm0.214

Rank 2 · TkA07G053100 · TK1151

Cell membrane0.033

Rank 3 · TkA07G053100 · TK1151

Endoplasmic reticulum0.033

Rank 4 · TkA07G053100 · TK1151

Plastid0.018

Rank 5 · TkA07G053100 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box55-94 aa

PF12937F-box-like55-89 aa

PF23622LRR_At1g61320_AtMIF1125-297 aa

PF24758LRR_At5g56370145-283 aa

PF00646F-box214-225 aa

PF00646F-box247-255 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G053100	`PF00646`	F-box	55	94	9.3e-05	22.9
TkA07G053100	`PF12937`	F-box-like	55	89	0.17	12.4
TkA07G053100	`PF23622`	LRR_At1g61320_AtMIF1	125	297	3.3e-16	60.4
TkA07G053100	`PF24758`	LRR_At5g56370	145	283	7.4e-14	52.7
TkA07G053100	`PF00646`	F-box	214	225	9.3e-05	22.9
TkA07G053100	`PF00646`	F-box	247	255	9.3e-05	22.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LV26`	Arabidopsis thaliana	sp\|Q9LV26\|FBL45_ARATH Putative F-box/LRR-repeat protein At3g18150	32.300%	Swiss-Prot	Medium
`Q9LYZ4`	Arabidopsis thaliana	sp\|Q9LYZ4\|FBL79_ARATH F-box/LRR-repeat protein At5g02910	33.500%	Swiss-Prot	Medium
`Q84W80`	Arabidopsis thaliana	sp\|Q84W80\|FBL42_ARATH F-box/LRR-repeat protein At3g03360	30.000%	Swiss-Prot	Medium
`Q9LSJ3`	Arabidopsis thaliana	sp\|Q9LSJ3\|FBL48_ARATH Putative F-box/LRR-repeat protein At3g28410	31.600%	Swiss-Prot	Low
`Q9LZ15`	Arabidopsis thaliana	sp\|Q9LZ15\|FBL78_ARATH Putative F-box/LRR-repeat protein At5g02700	26.500%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card