LXL04_027366 | RubberDandelionOmics

Gene overview

LXL04_027366

Reference: OH-1004 Chr: Chr06 Coordinates: 14361599-14383818 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

6792 bp · LXL04_027366|LXL04_027366|OH1004|cDNA

ATGGAAATGGTGGAAGAAGCGAGAGTCCCCCCAAAACGAATACAGTTTCAAGAAATCGTAGAGGAGGTAAAAGACGATCGATTCAGTGCCTTGCCAGATTGCTTACTTATTGAAATCCTCTCTCGTTTACCCTCCACAAAAGACGCCATTAGAACAGGTACACTCTCCAAACGTTGCAAACACCTTTGGACTATTGTTCCTACTCTAATCTTCAACGATTACGCTGAAAATCCCCTGTGGTTCGACATCGTCGACAAAAC...

CDS

Download CDS FASTA

6792 bp · LXL04_027366|LXL04_027366|OH1004|CDS

ATGGAAATGGTGGAAGAAGCGAGAGTCCCCCCAAAACGAATACAGTTTCAAGAAATCGTAGAGGAGGTAAAAGACGATCGATTCAGTGCCTTGCCAGATTGCTTACTTATTGAAATCCTCTCTCGTTTACCCTCCACAAAAGACGCCATTAGAACAGGTACACTCTCCAAACGTTGCAAACACCTTTGGACTATTGTTCCTACTCTAATCTTCAACGATTACGCTGAAAATCCCCTGTGGTTCGACATCGTCGACAAAAC...

Protein

Download Protein FASTA

2263 aa · LXL04_027366|LXL04_027366|OH1004|PROTEIN

MEMVEEARVPPKRIQFQEIVEEVKDDRFSALPDCLLIEILSRLPSTKDAIRTGTLSKRCKHLWTIVPTLIFNDYAENPLWFDIVDKTLTQCRQLKLKRFKVETSYDNRFQSQVDHWIRYAIRCNVEELNLSLWSNGLAAEFLLDQSFFVCSSFTDLSLLGCIFNPVGAISWKNLLRLRICDAKLDEDLIENILSGSPVLETLELDSCYGFRLLDITSKSVKKLVVYGYNDPEDEIDLLADVIFINAPNILSLSIQGNLLL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027366`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027366

Location Chr06:14361599-14383818 (+)

Description Similar to At1g49610: Putative F-box protein At1g49610

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g49610`	Putative F-box protein At1g49610.	No verified direct reference in this release
`At3g18150`	Putative F-box/LRR-repeat protein At3g18150.	No verified direct reference in this release
`At5g03100`	F-box protein At5g03100.	No verified direct reference in this release
`At3g03360`	F-box/LRR-repeat protein At3g03360.	No verified direct reference in this release
`At5g02700`	Putative F-box/LRR-repeat protein At5g02700.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027366 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G49610

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.542

Rank 1 · LXL04_027366 · OH-1004

Cytoplasm0.439

Rank 2 · LXL04_027366 · OH-1004

Cell membrane0.090

Rank 3 · LXL04_027366 · OH-1004

Endoplasmic reticulum0.069

Rank 4 · LXL04_027366 · OH-1004

Plastid0.031

Rank 5 · LXL04_027366 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23622.2LRR_At1g61320_AtMIF194-266 aa

PF24758.2LRR_At5g56370113-257 aa

PF23622.2LRR_At1g61320_AtMIF1507-677 aa

PF24758.2LRR_At5g56370526-667 aa

PF23622.2LRR_At1g61320_AtMIF1874-1045 aa

PF24758.2LRR_At5g56370894-1031 aa

PF02485.28Branch1172-1280 aa

PF23622.2LRR_At1g61320_AtMIF11557-1730 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027366	`PF23622.2`	LRR_At1g61320_AtMIF1	94	266	1.5e-70	239.3
LXL04_027366	`PF24758.2`	LRR_At5g56370	113	257	1.1e-67	228.7
LXL04_027366	`PF23622.2`	LRR_At1g61320_AtMIF1	507	677	1.5e-70	239.3
LXL04_027366	`PF24758.2`	LRR_At5g56370	526	667	1.1e-67	228.7
LXL04_027366	`PF23622.2`	LRR_At1g61320_AtMIF1	874	1045	1.5e-70	239.3
LXL04_027366	`PF24758.2`	LRR_At5g56370	894	1031	1.1e-67	228.7
LXL04_027366	`PF02485.28`	Branch	1172	1280	1.3e-15	58.4
LXL04_027366	`PF23622.2`	LRR_At1g61320_AtMIF1	1557	1730	1.5e-70	239.3
LXL04_027366	`PF24758.2`	LRR_At5g56370	1575	1719	1.1e-67	228.7
LXL04_027366	`PF00646.39`	F-box	1886	1927	9.3e-23	79.9
LXL04_027366	`PF23622.2`	LRR_At1g61320_AtMIF1	1953	2115	1.5e-70	239.3
LXL04_027366	`PF24758.2`	LRR_At5g56370	1976	2114	1.1e-67	228.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FX89`	Arabidopsis thaliana	Putative F-box protein At1g49610	33.036%	Swiss-Prot	weak database homology
`Q9LV26`	Arabidopsis thaliana	Putative F-box/LRR-repeat protein At3g18150	33.333%	Swiss-Prot	weak database homology
`Q501G5`	Arabidopsis thaliana	F-box protein At5g03100	32.278%	Swiss-Prot	weak database homology
`Q84W80`	Arabidopsis thaliana	F-box/LRR-repeat protein At3g03360	31.302%	Swiss-Prot	weak database homology
`Q9LZ15`	Arabidopsis thaliana	Putative F-box/LRR-repeat protein At5g02700	29.814%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card