TkA07G026730 | RubberDandelionOmics

Gene overview

TkA07G026730

Reference: TK1151 Chr: Chr07 Coordinates: 7207469-7209855 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1231 bp · TkA07G026730|TK1151|cDNA

GCACAGTATAGTCATTTTGTCACCTACCATAAAGTTCCATAATTCTCTCTCTCTCTCTCTCTTTGATTGAGAATATTTGAACTACCACCGAACCCAGAGGATTCTTCAAGAAACGATGACCTCGCGCGATAAGAAACCGGCAAAACCCTCAACCAGTCGACCTGGTGGTATCCGTACCCTCTCCGATTTGAATCGCCCAACCGCTAACGATTCCGATAGCGACTCCGATGGCCCTCAGGAGTACTACACCGGTGGCGAAA...

CDS

Download CDS FASTA

918 bp · TkA07G026730|TK1151|CDS

ATGACCTCGCGCGATAAGAAACCGGCAAAACCCTCAACCAGTCGACCTGGTGGTATCCGTACCCTCTCCGATTTGAATCGCCCAACCGCTAACGATTCCGATAGCGACTCCGATGGCCCTCAGGAGTACTACACCGGTGGCGAAAAGAGTGGTATGCTAGTTCAAGATCCAAATAAACGTAACGATGTGGATGAAATATTTAACCAAGCAAGACAATTAGGAGGTGTTGAAGGACCAATGGAAAACCTTCAACCCTCAAG...

Protein

Download Protein FASTA

305 aa · TkA07G026730|TK1151|PROTEIN

MTSRDKKPAKPSTSRPGGIRTLSDLNRPTANDSDSDSDGPQEYYTGGEKSGMLVQDPNKRNDVDEIFNQARQLGGVEGPMENLQPSSSRSFSGTGRLLTGEPVPAAPEQPQNVVHNIVFWRNGFTVNDGPLRRLDDPENAPFLESIRKSECPRELEPADRRSSVHVNLIRRDENRSERVVATQVAFQGQGRTLGSTTTDEANTSTTAATVPPITATSGGSGGLVLDTTLPSTSIQLRLADGTRMIAHFNHHHTVGDIRAF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G026730`
TK1151 ID	TkA07G026730
OH-1004 ID	LXL04_038122
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	64.300
Protein coverage (%)	TK1151 97.049 / OH-1004 66.968 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G026730

Location Chr07:7207469-7209855 (+)

Description Similar to PUX5: Plant UBX domain-containing protein 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g04210`	Plant UBX domain-containing protein 4.	No verified direct reference in this release
`At4g22150`	Plant UBX domain-containing protein 3.	No verified direct reference in this release
`At4g15410`	Plant UBX domain-containing protein 5.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038122 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000045 autophagosome assembly Biological Process

GO:0000132 establishment of mitotic spindle orientation Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0007030 Golgi organization Biological Process

GO:0031468 nuclear membrane reassembly Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0046604 positive regulation of mitotic centrosome separation Biological Process

GO:0061025 membrane fusion Biological Process

GO:1904780 negative regulation of protein localization to centrosome Biological Process

GO:0005634 nucleus Cellular Component

GO:0005694 chromosome Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT4G04210

ath:AT4G15410

ath:AT4G22150

hsa:55968

pon:100172420

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.702

Rank 1 · TkA07G026730 · TK1151

Nucleus0.587

Rank 2 · TkA07G026730 · TK1151

Endoplasmic reticulum0.054

Rank 3 · TkA07G026730 · TK1151

Cell membrane0.046

Rank 4 · TkA07G026730 · TK1151

Mitochondrion0.042

Rank 5 · TkA07G026730 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08059SEP85-96 aa

PF08059SEP117-191 aa

PF00789UBX230-304 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G026730	`PF08059`	SEP	85	96	1.1e-24	87.5
TkA07G026730	`PF08059`	SEP	117	191	1.1e-24	87.5
TkA07G026730	`PF00789`	UBX	230	304	5.5e-16	59.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RWU7`	Arabidopsis thaliana	sp\|Q8RWU7\|PUX4_ARATH Plant UBX domain-containing protein 4	69.000%	Swiss-Prot	High
`Q9SUG6`	Arabidopsis thaliana	sp\|Q9SUG6\|PUX3_ARATH Plant UBX domain-containing protein 3	67.200%	Swiss-Prot	High
`Q7Y175`	Arabidopsis thaliana	sp\|Q7Y175\|PUX5_ARATH Plant UBX domain-containing protein 5	57.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card