TkA06G479290 | RubberDandelionOmics

Gene overview

TkA06G479290

Reference: TK1151 Chr: Chr06 Coordinates: 118745060-118745898 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

753 bp · TkA06G479290|TK1151|cDNA

ATGCGATTGTGGCTCAAGATGGTTCGGGAACATTTTGGACCATCATGTATGCGGTTAGGATCTCCCAGAAATAACACAAAGCCATTTGTTATATTCATCAAAAAAGGTGTTTACTATGAGTATGTTGACATTCCTAGGGGTGCTAACAATGTCGTCTTCATCGGCGAAGGTCCAACAAAAACCAGAATCACTGGAAACAGGAATTACGACGAAGGAGAAGCAACTTATTCCACCGCCACTGTTGCGGTGAACGGAGATGG...

CDS

Download CDS FASTA

753 bp · TkA06G479290|TK1151|CDS

ATGCGATTGTGGCTCAAGATGGTTCGGGAACATTTTGGACCATCATGTATGCGGTTAGGATCTCCCAGAAATAACACAAAGCCATTTGTTATATTCATCAAAAAAGGTGTTTACTATGAGTATGTTGACATTCCTAGGGGTGCTAACAATGTCGTCTTCATCGGCGAAGGTCCAACAAAAACCAGAATCACTGGAAACAGGAATTACGACGAAGGAGAAGCAACTTATTCCACCGCCACTGTTGCGGTGAACGGAGATGG...

Protein

Download Protein FASTA

250 aa · TkA06G479290|TK1151|PROTEIN

MRLWLKMVREHFGPSCMRLGSPRNNTKPFVIFIKKGVYYEYVDIPRGANNVVFIGEGPTKTRITGNRNYDEGEATYSTATVAVNGDGFMAKDIGFENTAGPAKHQAVALRISGDMTIIHHCTIDRYQDTLYTHAYHQFYLQCTIRGTVDFIFGNAAAVFQDCTIIVRKPISNECVVTAQGRKDRHSHGGLILQNCTITGDPNYLATIPRPMTYLGRPWKLYSRTIIMESFIVTPVKISYVKVKPNCNGRY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G479290`
TK1151 ID	TkA06G479290
OH-1004 ID	LXL04_022531
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 90.800 / OH-1004 46.708 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G479290

Location Chr06:118745060-118745898 (-)

Description Similar to PME28: Putative pectinesterase/pectinesterase inhibitor 28

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g27870`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release
`At5g49180`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release
`At3g05610`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release
`At4g15980`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022531 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0042545 cell wall modification Biological Process

GO:0045490 pectin catabolic process Biological Process

GO:0048358 mucilage pectin biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0016020 membrane Cellular Component

GO:0090406 pollen tube Cellular Component

GO:0004857 enzyme inhibitor activity Molecular Function

GO:0030599 pectinesterase activity Molecular Function

GO:0046910 pectinesterase inhibitor activity Molecular Function

KEGG gene cross-reference

ath:AT3G05610

ath:AT3G06830

ath:AT5G27870

ath:AT5G49180

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.637

Rank 1 · TkA06G479290 · TK1151

Lysosome / Vacuole0.128

Rank 2 · TkA06G479290 · TK1151

Cytoplasm0.120

Rank 3 · TkA06G479290 · TK1151

Endoplasmic reticulum0.073

Rank 4 · TkA06G479290 · TK1151

Cell membrane0.067

Rank 5 · TkA06G479290 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01095Pectinesterase22-235 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G479290	`PF01095`	Pectinesterase	22	235	4e-92	308.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q3E8Z8`	Arabidopsis thaliana	sp\|Q3E8Z8\|PME28_ARATH Putative pectinesterase/pectinesterase inhibitor 28	56.900%	Swiss-Prot	High
`Q9FJ21`	Arabidopsis thaliana	sp\|Q9FJ21\|PME58_ARATH Probable pectinesterase/pectinesterase inhibitor 58	58.500%	Swiss-Prot	High
`Q8GX86`	Arabidopsis thaliana	sp\|Q8GX86\|PME21_ARATH Probable pectinesterase/pectinesterase inhibitor 21	56.400%	Swiss-Prot	High
`O23447`	Arabidopsis thaliana	sp\|O23447\|PME43_ARATH Putative pectinesterase/pectinesterase inhibitor 43	54.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card