LXL04_022531 | RubberDandelionOmics

Gene overview

LXL04_022531

Reference: OH-1004 Chr: Chr05 Coordinates: 354574-356142 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1461 bp · LXL04_022531|LXL04_022531|OH1004|cDNA

ATGGACAACGGAAACAGAAAGTTCACAATAATCGGAATTTCAGCTATTCTATTAATGACGGCGATGATTGGAGCAGCTGGTGCTGTATACACCAAATCAAACAATAGGGAACAAGATGTCACAACAAGCAATAAGGCAGTAAACTCACTTTGCCAACATACAGATTACCAGATATCGTGTCGAAAGAGTCTTGCCAATGCAAACGACACAGATGACGTAAAAAAGCTCGTGAAAATAGCTTTTAGTTCTGCGATAAAGGA...

CDS

Download CDS FASTA

1461 bp · LXL04_022531|LXL04_022531|OH1004|CDS

ATGGACAACGGAAACAGAAAGTTCACAATAATCGGAATTTCAGCTATTCTATTAATGACGGCGATGATTGGAGCAGCTGGTGCTGTATACACCAAATCAAACAATAGGGAACAAGATGTCACAACAAGCAATAAGGCAGTAAACTCACTTTGCCAACATACAGATTACCAGATATCGTGTCGAAAGAGTCTTGCCAATGCAAACGACACAGATGACGTAAAAAAGCTCGTGAAAATAGCTTTTAGTTCTGCGATAAAGGA...

Protein

Download Protein FASTA

486 aa · LXL04_022531|LXL04_022531|OH1004|PROTEIN

MDNGNRKFTIIGISAILLMTAMIGAAGAVYTKSNNREQDVTTSNKAVNSLCQHTDYQISCRKSLANANDTDDVKKLVKIAFSSAIKEIEHAINKSSTLHVIANDPRAAQALKICRSLLNTSIDDVKRSLKKLDNFDTEKMEEYLADLKVWLSGSLTYQQTCREGFKNTTGDSGKMMKKILELSGKLTSNVLDMVNSVGEYLGEFQLTTVSLTLLDNRLNDEDAWWASGDRRLLLDVDRKTLKPNAIVAQDGSGTFWTIIN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022531`
TK1151 ID	TkA06G479290
OH-1004 ID	LXL04_022531
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 90.800 / OH-1004 46.708 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022531

Location Chr05:354574-356142 (+)

Description Similar to PME28: Putative pectinesterase/pectinesterase inhibitor 28

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g27870`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release
`At5g49180`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release
`At3g05610`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release
`At3g06830`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022531 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0042545 cell wall modification Biological Process

GO:0045490 pectin catabolic process Biological Process

GO:0048358 mucilage pectin biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0016020 membrane Cellular Component

GO:0090406 pollen tube Cellular Component

GO:0004857 enzyme inhibitor activity Molecular Function

GO:0030599 pectinesterase activity Molecular Function

GO:0046910 pectinesterase inhibitor activity Molecular Function

KEGG gene cross-reference

ath:AT3G05610

ath:AT3G06830

ath:AT5G27870

ath:AT5G49180

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.387

Rank 1 · LXL04_022531 · OH-1004

Cell membrane0.289

Rank 2 · LXL04_022531 · OH-1004

Cytoplasm0.123

Rank 3 · LXL04_022531 · OH-1004

Endoplasmic reticulum0.107

Rank 4 · LXL04_022531 · OH-1004

Lysosome / Vacuole0.107

Rank 5 · LXL04_022531 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04043.21PMEI46-193 aa

PF01095.26Pectinesterase244-471 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022531	`PF04043.21`	PMEI	46	193	2.4e-28	99.9
LXL04_022531	`PF01095.26`	Pectinesterase	244	471	1.2e-92	310.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q3E8Z8`	Arabidopsis thaliana	Putative pectinesterase/pectinesterase inhibitor 28	45.148%	Swiss-Prot	moderate database homology
`Q9FJ21`	Arabidopsis thaliana	Probable pectinesterase/pectinesterase inhibitor 58	44.650%	Swiss-Prot	moderate database homology
`Q8GX86`	Arabidopsis thaliana	Probable pectinesterase/pectinesterase inhibitor 21	42.708%	Swiss-Prot	moderate database homology
`Q8GXA1`	Arabidopsis thaliana	Probable pectinesterase/pectinesterase inhibitor 23	40.289%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card