TkA06G389990 | RubberDandelionOmics

Gene overview

TkA06G389990

Reference: TK1151 Chr: Chr06 Coordinates: 96609111-96613001 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1406 bp · TkA06G389990|TK1151|cDNA

ATGGCTACGAATGAAGGTGTAATAGATGTTGACGATCAAAATGATGAAGTTGAAGTCCCTGAAAAAGAAAATAAGCCAAAGTTGACTGAGGTCGATATCTATCTAGCAGATAGAAAGGAAAAAAGGGACCCAAAGTTTGATCTTTTGGGATGGTGGAAAGCAAATTCAATCAAATTTTCTATACTATCCAAACTAGCTAGACGTGTTTTGGCAATGCCCATCTCGACAGTTGCATCGGAATTGGCGTTTAGTACGGGTGG...

CDS

Download CDS FASTA

1182 bp · TkA06G389990|TK1151|CDS

ATGGCTACGAATGAAGGTGTAATAGATGTTGACGATCAAAATGATGAAGTTGAAGTCCCTGAAAAAGAAAATAAGCCAAAGTTGACTGAGGTCGATATCTATCTAGCAGATAGAAAGGAAAAAAGGGACCCAAAGTTTGATCTTTTGGGATGGTGGAAAGCAAATTCAATCAAATTTTCTATACTATCCAAACTAGCTAGACGTGTTTTGGCAATGCCCATCTCGACAGTTGCATCGGAATTGGCGTTTAGTACGGGTGG...

Protein

Download Protein FASTA

393 aa · TkA06G389990|TK1151|PROTEIN

MATNEGVIDVDDQNDEVEVPEKENKPKLTEVDIYLADRKEKRDPKFDLLGWWKANSIKFSILSKLARRVLAMPISTVASELAFSTGGRVIDKYRSSLNTETAEALICAQDWIRNTRLDLELDRSMKNKDIDEFNENDDGFKHWKHYWKMMDFVQLWMLATDGRMRWKELEKLVLHLTQSVCINHHPLTLNSRRNGIRLKMAADDSTTTSANLEHNPDKKQGSKEIVIVCYGLQCTKDSLCVCSYFHDYSMMVDLSLALEK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G389990`
TK1151 ID	TkA06G389990
OH-1004 ID	LXL04_002412
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	54.700
Protein coverage (%)	TK1151 54.707 / OH-1004 39.829 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G389990

Location Chr06:96609111-96613001 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0733400`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release
`Os05g0583200`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release
`Os05g0239150`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002412 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.545

Rank 1 · TkA06G389990 · TK1151

Nucleus0.356

Rank 2 · TkA06G389990 · TK1151

Mitochondrion0.078

Rank 3 · TkA06G389990 · TK1151

Peroxisome0.060

Rank 4 · TkA06G389990 · TK1151

Endoplasmic reticulum0.058

Rank 5 · TkA06G389990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21565Tsi118-82 aa

PF05699Dimer_Tnp_hAT30-112 aa

PF00756Esterase126-144 aa

PF24471KH_DEAH11187-196 aa

PF08840BAAT_C196-230 aa

PF21565Tsi1229-243 aa

PF12146Hydrolase_4248-343 aa

PF24471KH_DEAH11252-265 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G389990	`PF21565`	Tsi1	18	82	0.12	12.8
TkA06G389990	`PF05699`	Dimer_Tnp_hAT	30	112	2.9e-26	91.8
TkA06G389990	`PF00756`	Esterase	126	144	0.021	15.4
TkA06G389990	`PF24471`	KH_DEAH11	187	196	0.22	11.9
TkA06G389990	`PF08840`	BAAT_C	196	230	0.0015	19.3
TkA06G389990	`PF21565`	Tsi1	229	243	0.12	12.8
TkA06G389990	`PF12146`	Hydrolase_4	248	343	8e-06	26.1
TkA06G389990	`PF24471`	KH_DEAH11	252	265	0.22	11.9
TkA06G389990	`PF12697`	Abhydrolase_6	252	327	0.37	12.1
TkA06G389990	`PF00561`	Abhydrolase_1	257	340	0.0076	16.7
TkA06G389990	`PF00756`	Esterase	275	327	0.021	15.4
TkA06G389990	`PF03959`	FSH1	286	392	0.0006	20.3
TkA06G389990	`PF08840`	BAAT_C	295	367	0.0015	19.3
TkA06G389990	`PF12146`	Hydrolase_4	352	391	8e-06	26.1
TkA06G389990	`PF24471`	KH_DEAH11	353	386	0.22	11.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6AVI0`	Oryza sativa subsp. japonica	sp\|Q6AVI0\|RSLE2_ORYSJ Zinc finger BED domain-containing protein RICESLEEPER 2	40.000%	Swiss-Prot	Low
`Q75HY5`	Oryza sativa subsp. japonica	sp\|Q75HY5\|RSLE3_ORYSJ Zinc finger BED domain-containing protein RICESLEEPER 3	46.800%	Swiss-Prot	Low
`B9FJG3`	Oryza sativa subsp. japonica	sp\|B9FJG3\|RSLE1_ORYSJ Zinc finger BED domain-containing protein RICESLEEPER 1	39.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card