TkA06G376990 | RubberDandelionOmics

Gene overview

TkA06G376990

Reference: TK1151 Chr: Chr06 Coordinates: 93376160-93378811 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2313 bp · TkA06G376990|TK1151|cDNA

AGTATATCAGAACATGACCTGTCATCTCCATTCGGCATTCTCACAGTCCACATAAAACGGATTCGATCTATCAAAAGTCAAAACAGAGAAACTGCAGACACTCAAGGAACAGAGGGAGATTGCGATGGACGGAAGAAGGCCGGAGAAGGAGAAAGACATCGATGATTTACCCAAGAACGAAGCAAACTACACAGCACTAACACCACTTTGGTTTTTGAAAAGAGCTGCTCTGGTTCACCCCCACCGCAGGTCGGTGGTGC...

CDS

Download CDS FASTA

1728 bp · TkA06G376990|TK1151|CDS

ATGGACGGAAGAAGGCCGGAGAAGGAGAAAGACATCGATGATTTACCCAAGAACGAAGCAAACTACACAGCACTAACACCACTTTGGTTTTTGAAAAGAGCTGCTCTGGTTCACCCCCACCGCAGGTCGGTGGTGCACGGTTCCATTCAGTACACATGGGTACAAACTTACGATCGTTGCTGCCGTTTAGCCTCCGCCCTTTCGAAACACTCCGTCGGGTTTGGTTCAACGGTAGCGGTGATTGCACCCAACATTCCAGC...

Protein

Download Protein FASTA

575 aa · TkA06G376990|TK1151|PROTEIN

MDGRRPEKEKDIDDLPKNEANYTALTPLWFLKRAALVHPHRRSVVHGSIQYTWVQTYDRCCRLASALSKHSVGFGSTVAVIAPNIPAIYEAHFGVPMSGAVINAINIRLNAPTIAFLLQHSASTVIIVDQEYFKLAENALAILKEETQTNFNPPILIVIKDESSECDPKNLQYAEAKGVMEYEKFLESGDPEFIWKPPRDEWQSIALGYTSGTTSNPKGVVLHHRGAYLAATSNIVVWGVPEGAVYLWTLPMFHCNGWSF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G376990`
TK1151 ID	TkA06G376990
OH-1004 ID	LXL04_023259
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 98.123 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G376990

Location Chr06:93376160-93378811 (-)

Description Similar to AAE7: Acetate/butyrate--CoA ligase AAE7, peroxisomal

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g16910`	Peroxisomal acetate/butyrate--CoA ligase that is probably involved in the activation of exogenous acetate for entry into the glyoxylate cycle.	Characterization of Arabidopsis fluoroacetate-resistant mutants reveals the principal mechanism of acetate activation for entry into the glyoxylate cycle.2005 · DOI: 10.1074/jbc.m407291200 Modelling the peroxisomal carbon leak during lipid mobilization in Arabidopsis.2010 · DOI: 10.1042/bst0381230 Evidence that ACN1 (acetate non-utilizing 1) prevents carbon leakage from peroxisomes during lipid mobilization in Arabidopsis seedlings.2011 · DOI: 10.1042/bj20101764
`At1g20560`	Catalyzes the ligation of CoA on butanoate to produce butanoyl-CoA.	No verified direct reference in this release
`At2g17650`	Catalyzes the ligation of CoA on isovalerate to produce 3-methylbutanoyl-CoA.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023259 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006083 acetate metabolic process Biological Process

GO:0006097 glyoxylate cycle Biological Process

GO:0006631 fatty acid metabolic process Biological Process

GO:0019605 butyrate metabolic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003987 acetate-CoA ligase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0016405 CoA-ligase activity Molecular Function

GO:0016874 ligase activity Molecular Function

KEGG gene cross-reference

ath:AT1G20560

ath:AT2G17650

ath:AT3G16910

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Peroxisome0.675

Rank 1 · TkA06G376990 · TK1151

Mitochondrion0.160

Rank 2 · TkA06G376990 · TK1151

Cytoplasm0.156

Rank 3 · TkA06G376990 · TK1151

Nucleus0.052

Rank 4 · TkA06G376990 · TK1151

Endoplasmic reticulum0.048

Rank 5 · TkA06G376990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00501AMP-binding32-424 aa

PF13193AMP-binding_C474-554 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G376990	`PF00501`	AMP-binding	32	424	7.3e-72	243.0
TkA06G376990	`PF13193`	AMP-binding_C	474	554	9.7e-20	72.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VZF1`	Arabidopsis thaliana	sp\|Q8VZF1\|AEE7_ARATH Acetate/butyrate--CoA ligase AAE7, peroxisomal	71.200%	Swiss-Prot	High
`F4HUK6`	Arabidopsis thaliana	sp\|F4HUK6\|AAE1_ARATH Butanoate--CoA ligase AAE1	51.500%	Swiss-Prot	High
`Q9SEY5`	Arabidopsis thaliana	sp\|Q9SEY5\|AAE2_ARATH Isovalerate--CoA ligase AAE2	49.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card