TkA06G368490 | RubberDandelionOmics

Gene overview

TkA06G368490

Reference: TK1151 Chr: Chr06 Coordinates: 91259038-91262471 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2328 bp · TkA06G368490|TK1151|cDNA

CGTGGATGGTGTGGTGTCGAAGCACTCTATGTATCATGTATGTTAGCCCATACCCGTCTCTTGTTCACCGTTTCTTTCTCTTCGCCTTGGGGTAGTGCTTGATTACAAAAGCAAAATTCGCACAAAAAATGCAAATGCTCTGTAGATCACTAGTACCTTCTGCCATGGCTGCTCTCCCTTCTTCCGAGGTTTCCTCCCTTTTCCCTCTTCACTCCTCACCCTTTCTAGTTTATCTCCTGTGTTAATTTGGTATATACTCT...

CDS

Download CDS FASTA

1077 bp · TkA06G368490|TK1151|CDS

ATGAGGGAGGAAAAGTTGAAAGGAAAAGGAACTCATATAGAAAAGTTAGGGGAAAGATCAGGAAGAATTTGTCAAAACTGGAAAAAAGCTGAATCAATCAACTTAGAAACCATGTCTCTCCATGACAATGTTTGGGAAAAGAAGGCAAGAAGAATGGTCTGTGTATGGCCAGGTATAAGGCAACTATGCCTTAGGAAACACCTTATGTATGGCTTTATGCAGTTGTTTTCATTTCCATTCAAAACCTTGAGAGGAGTCAG...

Protein

Download Protein FASTA

358 aa · TkA06G368490|TK1151|PROTEIN

MREEKLKGKGTHIEKLGERSGRICQNWKKAESINLETMSLHDNVWEKKARRMVCVWPGIRQLCLRKHLMYGFMQLFSFPFKTLRGVSRSLGVSHLCSISNMSTSLQIELVPCLKDNYAYLLHDLDTGTVGVVDPSESLPIIDALSKNNRNLTYILNTHHHYDHTGGNMDLKARYGAKVIGSNVDRDRIPGIDISLNDGDTWMFAGHEVHVIATPGHTKGHISFYFPASGAIFTGDTLFSLSCGKLFEGTPEQMHASLEKL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G368490`
TK1151 ID	TkA06G368490
OH-1004 ID	LXL04_023324
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G368490

Location Chr06:91259038-91262471 (-)

Description Similar to GLX2-4: Probable hydroxyacylglutathione hydrolase 2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g06130`	Thiolesterase that catalyzes the hydrolysis of S-D-lactoyl-glutathione to form glutathione and D-lactic acid.	No verified direct reference in this release
`At2g31350`	Thiolesterase that catalyzes the hydrolysis of S-D-lactoyl-glutathione to form glutathione and D-lactic acid.	No verified direct reference in this release
`At2g43430`	Thiolesterase that catalyzes the hydrolysis of S-D-lactoyl-glutathione to form glutathione and D-lactic acid.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023324 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009651 response to salt stress Biological Process

GO:0017001 antibiotic catabolic process Biological Process

GO:0019243 methylglyoxal catabolic process to D-lactate via S-lactoyl-glutathione Biological Process

GO:0034059 response to anoxia Biological Process

GO:0043200 response to amino acid Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004416 hydroxyacylglutathione hydrolase activity Molecular Function

GO:0005506 iron ion binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0008800 beta-lactamase activity Molecular Function

KEGG gene cross-reference

ath:AT1G06130

ath:AT2G31350

ath:AT2G43430

cya:CYA_1132

mmr:Mmar10_2381

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.603

Rank 1 · TkA06G368490 · TK1151

Cytoplasm0.249

Rank 2 · TkA06G368490 · TK1151

Nucleus0.114

Rank 3 · TkA06G368490 · TK1151

Peroxisome0.098

Rank 4 · TkA06G368490 · TK1151

Plastid0.080

Rank 5 · TkA06G368490 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16707CagS80-145 aa

PF00753Lactamase_B118-273 aa

PF23023Anti-Pycsar_Apyc1144-166 aa

PF12706Lactamase_B_2145-173 aa

PF19583ODP194-242 aa

PF23023Anti-Pycsar_Apyc1249-266 aa

PF16123HAGH_C274-358 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G368490	`PF16707`	CagS	80	145	0.096	13.4
TkA06G368490	`PF00753`	Lactamase_B	118	273	1.5e-22	81.3
TkA06G368490	`PF23023`	Anti-Pycsar_Apyc1	144	166	0.036	14.5
TkA06G368490	`PF12706`	Lactamase_B_2	145	173	0.0016	18.8
TkA06G368490	`PF19583`	ODP	194	242	0.054	14.1
TkA06G368490	`PF23023`	Anti-Pycsar_Apyc1	249	266	0.036	14.5
TkA06G368490	`PF16123`	HAGH_C	274	358	7e-26	91.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LDW8`	Arabidopsis thaliana	sp\|Q8LDW8\|GLO2D_ARATH Probable hydroxyacylglutathione hydrolase 2, chloroplastic	71.800%	Swiss-Prot	High
`Q9SID3`	Arabidopsis thaliana	sp\|Q9SID3\|GLO2N_ARATH Hydroxyacylglutathione hydrolase 2, mitochondrial	70.700%	Swiss-Prot	High
`O24495`	Arabidopsis thaliana	sp\|O24495\|GLO2M_ARATH Hydroxyacylglutathione hydrolase 1, mitochondrial	68.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card