TkA06G285490 | RubberDandelionOmics

Gene overview

TkA06G285490

Reference: TK1151 Chr: Chr06 Coordinates: 71982357-71986928 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2193 bp · TkA06G285490|TK1151|cDNA

ATGACGCTCTGCTACCTGCGACGACGACGACGCTCGGCCAAAAGCTTCACTCCCGCTGCGACGAAGATTTGCGAACTCAACGCCGGTAAACCCGATTTCGGCAGTAGCAGTCGATTGGCTTTGAACTTAAAGCCGGTAAACCCCATTTCAACTCCCCCGCTGCTACCTAGGGTTTCAGAAATCCGATTTTCGGCGGTTTTAATTTTCAGTTATCAAGTTCCTCCATTAATTGCAAACAAGACTGCTGTAGTTATAAGCCC...

CDS

Download CDS FASTA

2193 bp · TkA06G285490|TK1151|CDS

ATGACGCTCTGCTACCTGCGACGACGACGACGCTCGGCCAAAAGCTTCACTCCCGCTGCGACGAAGATTTGCGAACTCAACGCCGGTAAACCCGATTTCGGCAGTAGCAGTCGATTGGCTTTGAACTTAAAGCCGGTAAACCCCATTTCAACTCCCCCGCTGCTACCTAGGGTTTCAGAAATCCGATTTTCGGCGGTTTTAATTTTCAGTTATCAAGTTCCTCCATTAATTGCAAACAAGACTGCTGTAGTTATAAGCCC...

Protein

Download Protein FASTA

730 aa · TkA06G285490|TK1151|PROTEIN

MTLCYLRRRRRSAKSFTPAATKICELNAGKPDFGSSSRLALNLKPVNPISTPPLLPRVSEIRFSAVLIFSYQVPPLIANKTAVVISPLISLMQDRVMALKERGIRAEHLSTAQTNTSAQKNAESGQYDLLYMTPEKACNIPNRVRNDIIGSLMMKTLILQSDHLIEKTSTMVARSLCDGGINAAMYHGQMGSKACEESHRSFIRDEVQVMVATIAFGMGIDKPDIRHVIHYGCPKSLESYYQESGRCGRDGIGSDCWIYF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G285490`
TK1151 ID	TkA06G285490
OH-1004 ID	LXL04_020387
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	61.500
Protein coverage (%)	TK1151 25.068 / OH-1004 55.957 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G285490

Location Chr06:71982357-71986928 (+)

Description Similar to At5g03900: Uncharacterized protein At5g03900, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g31360`	3'-5' DNA helicase that may play a role in the repair of DNA.	AtRECQ2, a RecQ helicase homologue from Arabidopsis thaliana, is able to disrupt various recombinogenic DNA structures in vitro.2008 · DOI: 10.1111/j.0960-7412.2008.03511.x Biochemical characterization of AtRECQ3 reveals significant differences relative to other RecQ helicases.2009 · DOI: 10.1104/pp.109.144709 Fork sensing and strand switching control antagonistic activities of RecQ helicases.2013 · DOI: 10.1038/ncomms3024

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020387 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006260 DNA replication Biological Process

GO:0006281 DNA repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005694 chromosome Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0016592 mediator complex Cellular Component

GO:0031969 chloroplast membrane Cellular Component

KEGG gene cross-reference

ath:AT1G31360

ath:AT5G03900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.756

Rank 1 · TkA06G285490 · TK1151

Cytoplasm0.248

Rank 2 · TkA06G285490 · TK1151

Mitochondrion0.047

Rank 3 · TkA06G285490 · TK1151

Cell membrane0.033

Rank 4 · TkA06G285490 · TK1151

Endoplasmic reticulum0.023

Rank 5 · TkA06G285490 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00270DEAD78-141 aa

PF00271Helicase_C174-251 aa

PF02902Peptidase_C48283-354 aa

PF09716ETRAMP381-444 aa

PF02902Peptidase_C48426-447 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G285490	`PF00270`	DEAD	78	141	7.8e-05	23.2
TkA06G285490	`PF00271`	Helicase_C	174	251	8.5e-18	65.3
TkA06G285490	`PF02902`	Peptidase_C48	283	354	0.0075	16.8
TkA06G285490	`PF09716`	ETRAMP	381	444	0.13	13.0
TkA06G285490	`PF02902`	Peptidase_C48	426	447	0.0075	16.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FT73`	Arabidopsis thaliana	sp\|Q9FT73\|RECQ2_ARATH ATP-dependent DNA helicase Q-like 2	28.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card