TkA06G197310 | RubberDandelionOmics

Gene overview

TkA06G197310

Reference: TK1151 Chr: Chr06 Coordinates: 51347795-51356743 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2137 bp · TkA06G197310|TK1151|cDNA

AAAAGCCCTTATATAAATCCCACTCATTTGGTAATGTACCATTTTCCTATCCTTATATAAATCCCACTCATTTAGTAATGTACCATTTTCCTATACTTACTTTACGCATCTTTTTCATCGTAGTTCTTAACAGCATATATTAACATTTTTTCATCGGAGTTCTTAACAATATATATTAACCTTACACAACGCGCAGGATATCGCCTAGACTAGTTTTCTTATAGATTTCTTTATTGTTTTCTCTAAACTTGAATGGCACA...

CDS

Download CDS FASTA

1356 bp · TkA06G197310|TK1151|CDS

ATGGGAGGAAAGCATTCAAAGGAAGAAGGAGAGAGATATATGCAGACGCCGTCGTTCCAATTAACTTCATCATTTTCCGGTAATCAATACGGCGGTTATCCTCCTCAACCATCATATTCTCTTCCGCCACAACGAGATCAAAATTACCCTATTCAGGACCCCAATCCACAGCAACACTACACTTCGCTTCCAATTTATGGAACACAACCTTCTAGACCACAGAAAAAGCTTGAGAAAAGATATTCAAGAATTGCTGACAG...

Protein

Download Protein FASTA

451 aa · TkA06G197310|TK1151|PROTEIN

MGGKHSKEEGERYMQTPSFQLTSSFSGNQYGGYPPQPSYSLPPQRDQNYPIQDPNPQQHYTSLPIYGTQPSRPQKKLEKRYSRIADSYNSLEQVTEALAHAGLESSNLIVGIDFTKSNEWTGARSFHRKSLHHIGNDLNPYEQAISIIGKTLAAFDEDNLIPCYGFGDATTHDQDVFSFYPEDNFCNGFEDVMSRYREIIPHLKLSGPTSFAPVIEQAMTIVEQSGGQYHVLLIIADGQVTRSVDTDHGQLSPQEQKTVD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G197310`
TK1151 ID	TkA06G197310
OH-1004 ID	LXL04_023905
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	94.800
Protein coverage (%)	TK1151 99.778 / OH-1004 55.083 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G197310

Location Chr06:51347795-51356743 (+)

Description Similar to RGLG2: E3 ubiquitin-protein ligase RGLG2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g14420`	E3 ubiquitin-protein ligase that mediates the formation of 'Lys-63'-linked ubiquitin chains.	Ubiquitin lysine 63 chain forming ligases regulate apical dominance in Arabidopsis.2007 · DOI: 10.1105/tpc.107.052035 Arabidopsis RGLG2, functioning as a RING E3 ligase, interacts with AtERF53 and negatively regulates the plant drought stress response.2012 · DOI: 10.1104/pp.111.189738
`At3g01650`	E3 ubiquitin-protein ligase that mediates the formation of 'Lys-63'-linked ubiquitin chains.	Ubiquitin lysine 63 chain forming ligases regulate apical dominance in Arabidopsis.2007 · DOI: 10.1105/tpc.107.052035 Arabidopsis RGLG2, functioning as a RING E3 ligase, interacts with AtERF53 and negatively regulates the plant drought stress response.2012 · DOI: 10.1104/pp.111.189738
`At1g67800`	Together with RGLG1, mediates the ubiquitination and subsequent proteasomal degradation of the target protein PP2CA.	No verified direct reference in this release
`At5g63970`	Possesses E3 ubiquitin-protein ligase in vitro.	Two novel RING-type ubiquitin ligases, RGLG3 and RGLG4, are essential for jasmonate-mediated responses in Arabidopsis.2012 · DOI: 10.1104/pp.112.203422 Hijacking of the jasmonate pathway by the mycotoxin fumonisin B1 (FB1) to initiate programmed cell death in Arabidopsis is modulated by RGLG3 and RGLG4.2015 · DOI: 10.1093/jxb/erv068 The Arabidopsis Iron-Sulfur Protein GRXS17 is a Target of the Ubiquitin E3 Ligases RGLG3 and RGLG4.2016 · DOI: 10.1093/pcp/pcw122
`At1g79380`	Possesses E3 ubiquitin-protein ligase in vitro.	Two novel RING-type ubiquitin ligases, RGLG3 and RGLG4, are essential for jasmonate-mediated responses in Arabidopsis.2012 · DOI: 10.1104/pp.112.203422 Hijacking of the jasmonate pathway by the mycotoxin fumonisin B1 (FB1) to initiate programmed cell death in Arabidopsis is modulated by RGLG3 and RGLG4.2015 · DOI: 10.1093/jxb/erv068 The Arabidopsis Iron-Sulfur Protein GRXS17 is a Target of the Ubiquitin E3 Ligases RGLG3 and RGLG4.2016 · DOI: 10.1093/pcp/pcw122

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023905 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009690 cytokinin metabolic process Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process

GO:0009850 auxin metabolic process Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0070534 protein K63-linked ubiquitination Biological Process

GO:0080148 negative regulation of response to water deprivation Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004842 ubiquitin-protein transferase activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G67800

ath:AT3G01650

ath:AT5G14420

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.601

Rank 1 · TkA06G197310 · TK1151

Nucleus0.338

Rank 2 · TkA06G197310 · TK1151

Cell membrane0.196

Rank 3 · TkA06G197310 · TK1151

Lysosome / Vacuole0.123

Rank 4 · TkA06G197310 · TK1151

Golgi apparatus0.070

Rank 5 · TkA06G197310 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07002Copine130-343 aa

PF10138vWA-TerF-like153-308 aa

PF22605IBR_2220-232 aa

PF14634zf-RING_5404-411 aa

PF14447Prok-RING_4404-414 aa

PF13920zf-C3HC4_3405-446 aa

PF13639zf-RING_2407-441 aa

PF22605IBR_2407-443 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G197310	`PF07002`	Copine	130	343	9e-75	251.6
TkA06G197310	`PF10138`	vWA-TerF-like	153	308	5.2e-05	24.3
TkA06G197310	`PF22605`	IBR_2	220	232	2.0	9.4
TkA06G197310	`PF14634`	zf-RING_5	404	411	2.5	8.8
TkA06G197310	`PF14447`	Prok-RING_4	404	414	3.2	8.4
TkA06G197310	`PF13920`	zf-C3HC4_3	405	446	1.3e-09	38.4
TkA06G197310	`PF13639`	zf-RING_2	407	441	0.14	13.2
TkA06G197310	`PF22605`	IBR_2	407	443	2.0	9.4
TkA06G197310	`PF05605`	zf-Di19	407	443	2.5	9.1
TkA06G197310	`PF24921`	RING_XB3-XBAT31	407	437	8.0	7.3
TkA06G197310	`PF00097`	zf-C3HC4	408	440	0.00047	20.7
TkA06G197310	`PF13923`	zf-C3HC4_2	408	440	0.044	14.3
TkA06G197310	`PF21362`	Sina_RING	408	440	0.85	10.5
TkA06G197310	`PF14634`	zf-RING_5	408	441	2.5	8.8
TkA06G197310	`PF14447`	Prok-RING_4	408	444	3.2	8.4
TkA06G197310	`PF24921`	RING_XB3-XBAT31	435	445	8.0	7.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LY87`	Arabidopsis thaliana	sp\|Q9LY87\|RGLG2_ARATH E3 ubiquitin-protein ligase RGLG2	70.300%	Swiss-Prot	High
`Q9SS90`	Arabidopsis thaliana	sp\|Q9SS90\|RGLG1_ARATH E3 ubiquitin-protein ligase RGLG1	73.300%	Swiss-Prot	High
`Q8LB88`	Arabidopsis thaliana	sp\|Q8LB88\|RGLG5_ARATH E3 ubiquitin-protein ligase RGLG5	66.700%	Swiss-Prot	High
`Q8RX26`	Arabidopsis thaliana	sp\|Q8RX26\|RGLG3_ARATH E3 ubiquitin-protein ligase RGLG3	59.000%	Swiss-Prot	High
`Q9SAL0`	Arabidopsis thaliana	sp\|Q9SAL0\|RGLG4_ARATH E3 ubiquitin-protein ligase RGLG4	56.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card