RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_023905
Reference: OH-1004 Chr: Chr05 Coordinates: 73419517-73432076 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2541 bp · LXL04_023905|LXL04_023905|OH1004|cDNA

ATGGGAGGCAAGAATTCAAAGGAAGGAGGGGGGCATAAGCATTCGTCATCGTACGGCGGTTACCCTCCTCAACCATCGTCTACTCCGGCCTATGGCGCACAACCTCCTAGACCACAAAAGAAGCTTGACAGACGATATTCGAGAATCGCTGATAATTACAATTCTTTGGAACAGGTGACTGAGGCTCTTTCGCGTGCAGGACTGGAGTCTTCCAACCTCATTGTTGGTATCGATTTCACCAAAAGCAACGAGTGGACAGG...

CDS

Download CDS FASTA

2541 bp · LXL04_023905|LXL04_023905|OH1004|CDS

ATGGGAGGCAAGAATTCAAAGGAAGGAGGGGGGCATAAGCATTCGTCATCGTACGGCGGTTACCCTCCTCAACCATCGTCTACTCCGGCCTATGGCGCACAACCTCCTAGACCACAAAAGAAGCTTGACAGACGATATTCGAGAATCGCTGATAATTACAATTCTTTGGAACAGGTGACTGAGGCTCTTTCGCGTGCAGGACTGGAGTCTTCCAACCTCATTGTTGGTATCGATTTCACCAAAAGCAACGAGTGGACAGG...

Protein

Download Protein FASTA

846 aa · LXL04_023905|LXL04_023905|OH1004|PROTEIN

MGGKNSKEGGGHKHSSSYGGYPPQPSSTPAYGAQPPRPQKKLDRRYSRIADNYNSLEQVTEALSRAGLESSNLIVGIDFTKSNEWTGARSFHSKSLHHIGIDLNPYEQAISIIGKTLAAFDEDNLIPCYGFGDATTHDQNVFSFYREDSFCNGFEDVMSRYREIVPYLKLSGPTSFAPVIEQAMTIVEKSGGQYHVLLIIADGQVTRSVDTNRGQLSPQEQKTVEAIVAASKLPLSIVLVGVGDGPWDMMKEFDDNIPNR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_023905
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_023905
LocationChr05:73419517-73432076 (-)
DescriptionSimilar to RGLG2: E3 ubiquitin-protein ligase RGLG2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g14420 E3 ubiquitin-protein ligase that mediates the formation of 'Lys-63'-linked ubiquitin chains.
Ubiquitin lysine 63 chain forming ligases regulate apical dominance in Arabidopsis.2007 · DOI: 10.1105/tpc.107.052035
Arabidopsis RGLG2, functioning as a RING E3 ligase, interacts with AtERF53 and negatively regulates the plant drought stress response.2012 · DOI: 10.1104/pp.111.189738
At3g01650 E3 ubiquitin-protein ligase that mediates the formation of 'Lys-63'-linked ubiquitin chains.
Ubiquitin lysine 63 chain forming ligases regulate apical dominance in Arabidopsis.2007 · DOI: 10.1105/tpc.107.052035
Arabidopsis RGLG2, functioning as a RING E3 ligase, interacts with AtERF53 and negatively regulates the plant drought stress response.2012 · DOI: 10.1104/pp.111.189738
At1g67800 Together with RGLG1, mediates the ubiquitination and subsequent proteasomal degradation of the target protein PP2CA. No verified direct reference in this release
At5g63970 Possesses E3 ubiquitin-protein ligase in vitro.
Two novel RING-type ubiquitin ligases, RGLG3 and RGLG4, are essential for jasmonate-mediated responses in Arabidopsis.2012 · DOI: 10.1104/pp.112.203422
Hijacking of the jasmonate pathway by the mycotoxin fumonisin B1 (FB1) to initiate programmed cell death in Arabidopsis is modulated by RGLG3 and RGLG4.2015 · DOI: 10.1093/jxb/erv068
The Arabidopsis Iron-Sulfur Protein GRXS17 is a Target of the Ubiquitin E3 Ligases RGLG3 and RGLG4.2016 · DOI: 10.1093/pcp/pcw122
At1g79380 Possesses E3 ubiquitin-protein ligase in vitro.
Two novel RING-type ubiquitin ligases, RGLG3 and RGLG4, are essential for jasmonate-mediated responses in Arabidopsis.2012 · DOI: 10.1104/pp.112.203422
Hijacking of the jasmonate pathway by the mycotoxin fumonisin B1 (FB1) to initiate programmed cell death in Arabidopsis is modulated by RGLG3 and RGLG4.2015 · DOI: 10.1093/jxb/erv068
The Arabidopsis Iron-Sulfur Protein GRXS17 is a Target of the Ubiquitin E3 Ligases RGLG3 and RGLG4.2016 · DOI: 10.1093/pcp/pcw122

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_023905 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0009690 cytokinin metabolic process Biological Process
GO:0009738 abscisic acid-activated signaling pathway Biological Process
GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process
GO:0009850 auxin metabolic process Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0070534 protein K63-linked ubiquitination Biological Process
GO:0080148 negative regulation of response to water deprivation Biological Process
GO:0005576 extracellular region Cellular Component
GO:0005634 nucleus Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0004842 ubiquitin-protein transferase activity Molecular Function
GO:0008270 zinc ion binding Molecular Function
KEGG gene cross-reference
ath:AT1G67800
ath:AT3G01650
ath:AT5G14420
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.666
Rank 1 · LXL04_023905 · OH-1004
Nucleus0.353
Rank 2 · LXL04_023905 · OH-1004
Cell membrane0.122
Rank 3 · LXL04_023905 · OH-1004
Lysosome / Vacuole0.072
Rank 4 · LXL04_023905 · OH-1004
Endoplasmic reticulum0.050
Rank 5 · LXL04_023905 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07002.23Copine95-309 aa
PF10138.16vWA-TerF-like119-273 aa
PF07002.23Copine509-737 aa
PF13920.13zf-C3HC4_3800-841 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_023905PF07002.23Copine953091.9e-143476.1
LXL04_023905PF10138.16vWA-TerF-like1192736.6e-0937.0
LXL04_023905PF07002.23Copine5097371.9e-143476.1
LXL04_023905PF13920.13zf-C3HC4_38008412.5e-1040.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LY87Arabidopsis thalianaE3 ubiquitin-protein ligase RGLG270.913%Swiss-Protweak database homology
Q9SS90Arabidopsis thalianaE3 ubiquitin-protein ligase RGLG168.447%Swiss-Protweak database homology
Q8LB88Arabidopsis thalianaE3 ubiquitin-protein ligase RGLG563.593%Swiss-Protweak database homology
Q8RX26Arabidopsis thalianaE3 ubiquitin-protein ligase RGLG357.143%Swiss-Protweak database homology
Q9SAL0Arabidopsis thalianaE3 ubiquitin-protein ligase RGLG452.821%Swiss-Protweak database homology

JBrowse

View in Genome Browser