TkA06G101790 | RubberDandelionOmics

Gene overview

TkA06G101790

Reference: TK1151 Chr: Chr06 Coordinates: 27037560-27040390 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1831 bp · TkA06G101790|TK1151|cDNA

ATAAAAGTATTAAGAAAAAACATCGATAATGCTCAACCCTAACCCCAAGTCCCAACTTCCCGAGTAGCTTTTGGTCGTTTGTTATACGCAATACGCCTACTCGACCAGAGCAGTTTGGGCTTCCGTTCGACCCAAAACGGTGGTTAGTTCATAGTCACCTTCGCACTATTTAAACTCTACCAAAGAGAACAAGGGCCGGAGAGAGAGAGAGATGCAGGAGAAAACCAAGTGTCTGGCTTTAATCGGTGCCGGTGCTCTCT...

CDS

Download CDS FASTA

1380 bp · TkA06G101790|TK1151|CDS

ATGCAGGAGAAAACCAAGTGTCTGGCTTTAATCGGTGCCGGTGCTCTCTTGGGCTCCATTACTGCCACCGTAGCTGTTCTCAAGCTTCTTCCTCCTAGAGTAGCTGCGGTTCAATGCAACAATGATGCCAAATCAAATGAATACAACAGTTCACCGAAAGAGGAAACAGATGCAATCGACCCTGTAGACCTCTTAAAAGACGAAATAGTTTCTGAACAGCTCACCAGGAATATACAATTCTTTGGCTTTGAAGCCCAACA...

Protein

Download Protein FASTA

459 aa · TkA06G101790|TK1151|PROTEIN

MQEKTKCLALIGAGALLGSITATVAVLKLLPPRVAAVQCNNDAKSNEYNSSPKEETDAIDPVDLLKDEIVSEQLTRNIQFFGFEAQQKVTTSYVVVIGLGGVGSHAASMLLRSGVGRLLLVDFDQVSLSSLNRHAVATRTDVGTPKAVCLKKHFSSICPECHIDAKVMLYDASSEEEILSGDPDFVLDCIDNIDTKVALLAACVRRGLKVLSATGAGARADPTRIRVADLRESTNDPLSRSVRQRLRRDHGIEGGIPVVF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G101790`
TK1151 ID	TkA06G101790
OH-1004 ID	LXL04_030804
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	31.800
Protein coverage (%)	TK1151 25.490 / OH-1004 30.588 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G101790`
Location	Chr06:27037560-27040390 (-)
Description	Similar to At1g05350: Ubiquitin-like modifier-activating enzyme 5
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_030804` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0032649 regulation of type II interferon production Biological Process GO:0033146 regulation of intracellular estrogen receptor signaling pathway Biological Process GO:0034976 response to endoplasmic reticulum stress Biological Process GO:0061709 reticulophagy Biological Process GO:0071569 protein ufmylation Biological Process GO:1990592 protein K69-linked ufmylation Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0005794 Golgi apparatus Cellular Component GO:0005829 cytosol Cellular Component GO:0005524 ATP binding Molecular Function
KEGG gene cross-reference	ath:AT1G05350 bta:509292 dosa:Os02g0506500 mmu:66663 rno:300968 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.502

Rank 1 · TkA06G101790 · TK1151

Cytoplasm0.250

Rank 2 · TkA06G101790 · TK1151

Nucleus0.140

Rank 3 · TkA06G101790 · TK1151

Peroxisome0.130

Rank 4 · TkA06G101790 · TK1151

Plastid0.071

Rank 5 · TkA06G101790 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00899ThiF75-333 aa

PF03435Sacchrp_dh_NADP94-212 aa

PF02254TrkA_N94-137 aa

PF02558ApbA94-142 aa

PF06504RepC219-246 aa

PF06504RepC309-407 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G101790	`PF00899`	ThiF	75	333	2.2e-46	158.7
TkA06G101790	`PF03435`	Sacchrp_dh_NADP	94	212	0.00011	23.3
TkA06G101790	`PF02254`	TrkA_N	94	137	0.047	14.7
TkA06G101790	`PF02558`	ApbA	94	142	0.21	11.9
TkA06G101790	`PF06504`	RepC	219	246	0.086	12.8
TkA06G101790	`PF06504`	RepC	309	407	0.086	12.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card