TkA06G078460 | RubberDandelionOmics

Gene overview

TkA06G078460

Reference: TK1151 Chr: Chr06 Coordinates: 21054233-21056083 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1208 bp · TkA06G078460|TK1151|cDNA

GTCAAATGTAAGTTTATGTTTTATTTTATTTTAATGCGATTTGAGCTTTAAAGTTGAAGAATAAGGTTGAGCCATGTTTCTTGGAGTGTCTTCTCTGTTCCTCCCCTCTTCTCCCATCCAAACTTCACACTCGTTCACTCCCTTCCATCAGCTCAACGTCAAATTGAATTTGTATCTTCGTAAATCTACCCCCAAATCGAGCCAAAACGTTACGAATTCGCCATCAACGTCATCATGTGTCAGCAGCAGGAAGAATATTT...

CDS

Download CDS FASTA

957 bp · TkA06G078460|TK1151|CDS

ATGTTTCTTGGAGTGTCTTCTCTGTTCCTCCCCTCTTCTCCCATCCAAACTTCACACTCGTTCACTCCCTTCCATCAGCTCAACGTCAAATTGAATTTGTATCTTCGTAAATCTACCCCCAAATCGAGCCAAAACGTTACGAATTCGCCATCAACGTCATCATGTGTCAGCAGCAGGAAGAATATTTGTTTATGTGGGAGACGGCCATTTTTAGCAACAATTTCAACAGCTCTCATCCCAATTCGATATTCCAATGGTTT...

Protein

Download Protein FASTA

318 aa · TkA06G078460|TK1151|PROTEIN

MFLGVSSLFLPSSPIQTSHSFTPFHQLNVKLNLYLRKSTPKSSQNVTNSPSTSSCVSSRKNICLCGRRPFLATISTALIPIRYSNGLDSLPDDPMAVLNRVHPPRPDWYEEFYAKAMDTTMKSYEAEIAGYKSQLFAKITGKATNILEIGIGTGPNLKYYATATSNTNIIGVDPNKKMEKYALAAAHASGLPQKNFKFIHAVAESLPVSDASMDAVVGTLVLCSVKDVHKTLQEIKRVLKPGGVYIFVEHVAAKDGTILK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G078460`
TK1151 ID	TkA06G078460
OH-1004 ID	LXL04_025150
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G078460`
Location	Chr06:21054233-21056083 (-)
Description	Similar to Mettl7b: Methyltransferase-like protein 7B
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_025150` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0032259 methylation Biological Process GO:0180035 lncRNA processing Biological Process GO:0005576 extracellular region Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0005811 lipid droplet Cellular Component GO:0005829 cytosol Cellular Component GO:0016020 membrane Cellular Component GO:1904724 tertiary granule lumen Cellular Component GO:0001734 mRNA m(6)A methyltransferase activity Molecular Function GO:0008168 methyltransferase activity Molecular Function GO:0008173 RNA methyltransferase activity Molecular Function
KEGG gene cross-reference	bsu:BSU03160 hsa:196410 hsa:25840 mmu:71664 rno:366792 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.967

Rank 1 · TkA06G078460 · TK1151

Mitochondrion0.041

Rank 2 · TkA06G078460 · TK1151

Nucleus0.016

Rank 3 · TkA06G078460 · TK1151

Cytoplasm0.015

Rank 4 · TkA06G078460 · TK1151

Cell membrane0.013

Rank 5 · TkA06G078460 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13489Methyltransf_23132-253 aa

PF24675NpmA134-242 aa

PF13847Methyltransf_31142-252 aa

PF01209Ubie_methyltran142-250 aa

PF06080DUF938142-245 aa

PF02390Methyltransf_4144-203 aa

PF13649Methyltransf_25146-243 aa

PF00891Methyltransf_2146-257 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G078460	`PF13489`	Methyltransf_23	132	253	7e-14	52.6
TkA06G078460	`PF24675`	NpmA	134	242	4.5e-05	23.6
TkA06G078460	`PF13847`	Methyltransf_31	142	252	1.4e-14	54.9
TkA06G078460	`PF01209`	Ubie_methyltran	142	250	3e-12	47.1
TkA06G078460	`PF06080`	DUF938	142	245	0.00029	21.4
TkA06G078460	`PF02390`	Methyltransf_4	144	203	0.00035	20.8
TkA06G078460	`PF13649`	Methyltransf_25	146	243	8.3e-19	68.8
TkA06G078460	`PF00891`	Methyltransf_2	146	257	0.21	11.6
TkA06G078460	`PF08241`	Methyltransf_11	147	247	2.9e-22	79.8
TkA06G078460	`PF08242`	Methyltransf_12	147	244	4.3e-14	53.7
TkA06G078460	`PF05148`	Methyltransf_8	204	249	0.00017	22.3
TkA06G078460	`PF20922`	Anamorsin_N	210	255	0.012	16.1
TkA06G078460	`PF02390`	Methyltransf_4	230	247	0.00035	20.8
TkA06G078460	`PF08242`	Methyltransf_12	274	277	4.3e-14	53.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card