TkA06G066060 | RubberDandelionOmics

Gene overview

TkA06G066060

Reference: TK1151 Chr: Chr06 Coordinates: 17732585-17735052 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1273 bp · TkA06G066060|TK1151|cDNA

ATAGGTATTGCTGACCCTTGATCTGATACAATTAACGGATGTACAAGTAAAGATAACACCACAAGATACTCTCTCACAATACATCAATGCCGGAAGCCTTAAACCATCGACATTCGACATTGCTCACTCGCTCTCTCGCTCGCTCCCCCCAGCCCTTCTGTATCTCCGGCGAAGTCGGAAGTGTAGATGCGGTCTCTCCTTTCTCTCCTTTCGCCATCTCCGTCTTTATCCACCCTACTCACCTCTCTACTCAATTCCTA...

CDS

Download CDS FASTA

441 bp · TkA06G066060|TK1151|CDS

ATGCGGTCTCTCCTTTCTCTCCTTTCGCCATCTCCGTCTTTATCCACCCTACTCACCTCTCTACTCAATTCCTACATCATTCTCTGCACCTCCAACAAAATTCCCCATGATCGGCGTTCCCTTAAAACCCTGGAACTCTTCTCTCCTCATCTGGAAAACATCCCAATCAACGAACTACAAACAATCTCTGATACAATCGTTTCGAGTATCTCTCAAATCGACAGAGATCCAGACGAAGCGCAGCTTCTCGACTTACTTCC...

Protein

Download Protein FASTA

146 aa · TkA06G066060|TK1151|PROTEIN

MRSLLSLLSPSPSLSTLLTSLLNSYIILCTSNKIPHDRRSLKTLELFSPHLENIPINELQTISDTIVSSISQIDRDPDEAQLLDLLPKCLHIIFNSNEIDKPQDSVDAVFDRILECNWSRILLVKLVSITNLLFIAREALKIGRNS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G066060`
TK1151 ID	TkA06G066060
OH-1004 ID	LXL04_029881
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.400
Protein coverage (%)	TK1151 86.986 / OH-1004 9.387 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G066060`
Location	Chr06:17732585-17735052 (-)
Description	Similar to FANCI: Fanconi anemia group I protein
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_029881` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006281 DNA repair Biological Process GO:0031398 positive regulation of protein ubiquitination Biological Process GO:0036297 interstrand cross-link repair Biological Process GO:0000785 chromatin Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0016020 membrane Cellular Component GO:0043240 Fanconi anaemia nuclear complex Cellular Component GO:1990391 DNA repair complex Cellular Component GO:0003677 DNA binding Molecular Function GO:0070182 DNA polymerase binding Molecular Function
KEGG gene cross-reference	gga:415491 hsa:55215 mmu:208836 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.577

Rank 1 · TkA06G066060 · TK1151

Cytoplasm0.495

Rank 2 · TkA06G066060 · TK1151

Mitochondrion0.051

Rank 3 · TkA06G066060 · TK1151

Endoplasmic reticulum0.036

Rank 4 · TkA06G066060 · TK1151

Cell membrane0.028

Rank 5 · TkA06G066060 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30700ARM_GAC_1st12-116 aa

PF14675FANCI_S139-103 aa

PF27739PEX8_C47-118 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G066060	`PF30700`	ARM_GAC_1st	12	116	0.078	10.9
TkA06G066060	`PF14675`	FANCI_S1	39	103	0.083	13.1
TkA06G066060	`PF27739`	PEX8_C	47	118	0.11	13.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card