LXL04_029881 | RubberDandelionOmics

Gene overview

LXL04_029881

Reference: OH-1004 Chr: Chr06 Coordinates: 102765508-102770612 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4062 bp · LXL04_029881|LXL04_029881|OH1004|cDNA

ATGCCAAGTGACACTTTTTCCCGCGCTCGGGAAATCCACAAAACCCACTCACAACTTTGTCTGCTATCGAACTACGGTTGCGCCACCATGACCACCGCCACCAGCGTTAACCACCGTAGCAACTCGCCGCCCCTCACCCCGGACGACATAATCCGCTTAGCTCAATACCACACTACTGCACCGCTTCATCCTTACCTCCTTGCCCCAACTTCTCACGACACCCTCGTCTCCCACCTCCACACACTCCCTCCCTCCGCCGT...

CDS

Download CDS FASTA

4062 bp · LXL04_029881|LXL04_029881|OH1004|CDS

ATGCCAAGTGACACTTTTTCCCGCGCTCGGGAAATCCACAAAACCCACTCACAACTTTGTCTGCTATCGAACTACGGTTGCGCCACCATGACCACCGCCACCAGCGTTAACCACCGTAGCAACTCGCCGCCCCTCACCCCGGACGACATAATCCGCTTAGCTCAATACCACACTACTGCACCGCTTCATCCTTACCTCCTTGCCCCAACTTCTCACGACACCCTCGTCTCCCACCTCCACACACTCCCTCCCTCCGCCGT...

Protein

Download Protein FASTA

1353 aa · LXL04_029881|LXL04_029881|OH1004|PROTEIN

MPSDTFSRAREIHKTHSQLCLLSNYGCATMTTATSVNHRSNSPPLTPDDIIRLAQYHTTAPLHPYLLAPTSHDTLVSHLHTLPPSAVSEYTSSLLSLLSPSPSLSTLLTSLLNSYIILFTSNKIPHDRRSLKTLELFSPHLENIPINELQTISHTIVSSISQIDRDPDEAQLLDLLPKCLHIIFNSNEIDKPQDSVDAVFDRILECNWSRILLVKLVSIIHEFKFVGKGRGKLFAQKVFDNMHCVELQDLPSLVYQLLVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029881`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_029881`
Location	Chr06:102765508-102770612 (-)
Description	Similar to FANCI: Fanconi anemia group I protein
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_029881` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006281 DNA repair Biological Process GO:0031398 positive regulation of protein ubiquitination Biological Process GO:0036297 interstrand cross-link repair Biological Process GO:0000785 chromatin Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0016020 membrane Cellular Component GO:0043240 Fanconi anaemia nuclear complex Cellular Component GO:1990391 DNA repair complex Cellular Component GO:0003677 DNA binding Molecular Function GO:0070182 DNA polymerase binding Molecular Function
KEGG gene cross-reference	gga:415491 hsa:55215 mmu:208836 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.907

Rank 1 · LXL04_029881 · OH-1004

Cytoplasm0.168

Rank 2 · LXL04_029881 · OH-1004

Cell membrane0.033

Rank 3 · LXL04_029881 · OH-1004

Endoplasmic reticulum0.023

Rank 4 · LXL04_029881 · OH-1004

Mitochondrion0.018

Rank 5 · LXL04_029881 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14675.13FANCI_S1136-308 aa

PF14679.13FANCI_HD1312-393 aa

PF14676.13FANCI_S2406-559 aa

PF14680.13FANCI_HD2578-799 aa

PF14678.13FANCI_S41051-1285 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029881	`PF14675.13`	FANCI_S1	136	308	1.7e-16	61.1
LXL04_029881	`PF14679.13`	FANCI_HD1	312	393	4.1e-20	72.2
LXL04_029881	`PF14676.13`	FANCI_S2	406	559	1.5e-48	165.6
LXL04_029881	`PF14680.13`	FANCI_HD2	578	799	3e-43	148.5
LXL04_029881	`PF14678.13`	FANCI_S4	1051	1285	1.2e-61	208.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card