TkA06G063040 | RubberDandelionOmics

Gene overview

TkA06G063040

Reference: TK1151 Chr: Chr06 Coordinates: 17009916-17013354 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3152 bp · TkA06G063040|TK1151|cDNA

AAACAGTAATACCGTCTAGGTTCTCTTCATGTGATCAAAAGAAATTGCTGCCCGTTGTCCCTTTTTCGTCTGTTCATGGTTTAGAGGGTGATTGGTTAATCGAATAAATGGAGGTTTCTTGCTTCAATGAGCTCGATTTTCGTCTCGTATGAAGTGGTTTCTTGTTTATTAATTGGATTTTTGTCTTGTGGTTGGTGGGTTCTTACTTTAAGCTCAACTTGAAGGGTTTTGGGGTCAACGGATTCAAGAAACCTATCGCA...

CDS

Download CDS FASTA

2280 bp · TkA06G063040|TK1151|CDS

ATGTCGAAAAGTTTAGTATTTGGAGTCTTGATTGCTTCTTTGTTTCTATCAGTTTCGTTAGCTAACGATAACGAATTCGCTCACTGTCACTGTGATGATGAAGGATCATGGAATGCACATATAATCGAAAGCCAAAGAGTAAGCGATTTCTTGATAGCAATCGCGTATTTTTCAATCCCACTCGAATTACTTTACTTTCTTAGTTGTTCAAACGTGCCGTTCAAATGGGTTCTCGTTCAATTCATCGCATTCATCGTTCT...

Protein

Download Protein FASTA

759 aa · TkA06G063040|TK1151|PROTEIN

MSKSLVFGVLIASLFLSVSLANDNEFAHCHCDDEGSWNAHIIESQRVSDFLIAIAYFSIPLELLYFLSCSNVPFKWVLVQFIAFIVLCGLTHLINGWGYYGNQTFQLMMALTVAKLLTALVSCATAITLLTLIPLLLKFKVRELFLKQNVLELDQEVGIMKKQKEAGWHVRMLTHEIRKSLDRHTILYTTLVELSNTLVLQNCAVWMLNDSKSEMNLTHELRPNSSGYHSSIPKNDPDVLHITGKKGVTMLRVDSELAIQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G063040`
TK1151 ID	TkA06G063040
OH-1004 ID	LXL04_035658
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 97.809 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G063040

Location Chr06:17009916-17013354 (-)

Description Similar to EIN4: Protein EIN4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g04580`	Ethylene receptor related to bacterial two-component regulators.	No verified direct reference in this release
`At3g23150`	Ethylene receptor related to bacterial two-component regulators.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0169100`	Ethylene receptor related to bacterial two-component regulators.	The ethylene receptor ETR2 delays floral transition and affects starch accumulation in rice.2009 · DOI: 10.1105/tpc.108.065391
`UniProt: Q8H1X1`	Ethylene receptor related to bacterial two-component regulators.	No verified direct reference in this release
`UniProt: Q6T5K2`	Ethylene receptor related to bacterial two-component regulators.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035658 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009723 response to ethylene Biological Process

GO:0010105 negative regulation of ethylene-activated signaling pathway Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:2000904 regulation of starch metabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0000155 phosphorelay sensor kinase activity Molecular Function

GO:0004673 protein histidine kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT3G04580

ath:AT3G23150

dosa:Os04g0169100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.376

Rank 1 · TkA06G063040 · TK1151

Golgi apparatus0.163

Rank 2 · TkA06G063040 · TK1151

Cell membrane0.139

Rank 3 · TkA06G063040 · TK1151

Cytoplasm0.134

Rank 4 · TkA06G063040 · TK1151

Nucleus0.133

Rank 5 · TkA06G063040 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25487ETR1_N41-138 aa

PF00512HisKA170-179 aa

PF01590GAF182-329 aa

PF00512HisKA216-222 aa

PF01229Glyco_hydro_39307-409 aa

PF24896Receiver_CRE1360-360 aa

PF00512HisKA366-430 aa

PF02518HATPase_c477-598 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G063040	`PF25487`	ETR1_N	41	138	6.7e-41	139.7
TkA06G063040	`PF00512`	HisKA	170	179	1.7e-11	44.7
TkA06G063040	`PF01590`	GAF	182	329	1e-08	36.5
TkA06G063040	`PF00512`	HisKA	216	222	1.7e-11	44.7
TkA06G063040	`PF01229`	Glyco_hydro_39	307	409	0.063	12.8
TkA06G063040	`PF24896`	Receiver_CRE1	360	360	0.044	14.7
TkA06G063040	`PF00512`	HisKA	366	430	1.7e-11	44.7
TkA06G063040	`PF02518`	HATPase_c	477	598	0.0018	19.4
TkA06G063040	`PF24896`	Receiver_CRE1	626	670	0.044	14.7
TkA06G063040	`PF00072`	Response_reg	633	744	1.5e-21	77.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZTP3`	Arabidopsis thaliana	sp\|Q9ZTP3\|EIN4_ARATH Protein EIN4	58.900%	Swiss-Prot	High
`Q0WPQ2`	Arabidopsis thaliana	sp\|Q0WPQ2\|ETR2_ARATH Ethylene receptor 2	52.300%	Swiss-Prot	High
`Q7XX84`	Oryza sativa subsp. japonica	sp\|Q7XX84\|ETR2_ORYSJ Ethylene receptor 2	53.000%	Swiss-Prot	High
`Q8H1X1`	Oryza sativa subsp. indica	sp\|Q8H1X1\|ETR2_ORYSI Ethylene receptor 2	52.800%	Swiss-Prot	High
`Q6T5K2`	Oryza sativa subsp. indica	sp\|Q6T5K2\|ETR3_ORYSI Ethylene receptor 3	50.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card