TkA06G033230 | RubberDandelionOmics

Gene overview

TkA06G033230

Reference: TK1151 Chr: Chr06 Coordinates: 8983827-8987249 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1632 bp · TkA06G033230|TK1151|cDNA

GAAATAATGCCACTTCCCTGTCATTACCAATAGCCATAATTAGTTGACTATTAATTTTAGATCATTATAAAGGAAACATAGCGTCGCCTTCATTAAATACAAACACCCCCTACCCAAGGAACAAGACACCAGAAACACCTACCTCGGTATATGGGATTAGAAACTGGAAACAACACGGCGGTCGCCGGTCATCAACATGGCATATCTCCACCACCGGAGTCCACACCCCACCACCACCTCCACCTCCTTCCCCCTTCCTC...

CDS

Download CDS FASTA

1155 bp · TkA06G033230|TK1151|CDS

ATGGGATTAGAAACTGGAAACAACACGGCGGTCGCCGGTCATCAACATGGCATATCTCCACCACCGGAGTCCACACCCCACCACCACCTCCACCTCCTTCCCCCTTCCTCTAGTTTCCTCCTACAAACTCCAAAAGTGGTGATCATCTTTGCTATGATGGCATTTTCATGCTTGCTTCTTTATCGTGCTTCTCCTTCTGTATGGTTTCCGATCAGCTATAATTCTTTCGGTACCAATTCAGAGAACAAAGCAGATGACTT...

Protein

Download Protein FASTA

384 aa · TkA06G033230|TK1151|PROTEIN

MGLETGNNTAVAGHQHGISPPPESTPHHHLHLLPPSSSFLLQTPKVVIIFAMMAFSCLLLYRASPSVWFPISYNSFGTNSENKADDLKNILIKAATSDNTVILTTLNDAWAEPNSMFDIFLESFQIGNQTQRFLNHLVVIAMDQKAYARCLKLHPHCYNLGTNGMDFSEEAYFMAPDYLKMMWRRIDFLHTILDLGYNFLFTDADIMWFRDPFPHFHEDGDFQIACDYFRGNPIDLNNLPNGGFTYVKSNSKTIQFYKYW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G033230`
TK1151 ID	TkA06G033230
OH-1004 ID	LXL04_025875
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G033230

Location Chr06:8983827-8987249 (+)

Description Similar to At4g15970: Uncharacterized protein At4g15970

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g15970`	Uncharacterized protein At4g15970.	No verified direct reference in this release
`At1g28695`	Uncharacterized protein At1g28695.	No verified direct reference in this release
`At1g56550`	Catalyzes the transfer of D-xylose from UDP-alpha-D-xylose onto L-fucose.	Functional characterisation of a putative rhamnogalacturonan II specific xylosyltransferase.2008 · DOI: 10.1016/j.febslet.2008.08.015

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025875 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010306 rhamnogalacturonan II biosynthetic process Biological Process

GO:0042546 cell wall biogenesis Biological Process

GO:0048868 pollen tube development Biological Process

GO:0071555 cell wall organization Biological Process

GO:0000138 Golgi trans cisterna Cellular Component

GO:0000139 Golgi membrane Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016757 glycosyltransferase activity Molecular Function

GO:0035252 UDP-xylosyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G28695

ath:AT1G56550

ath:AT1G70630

ath:AT4G01220

ath:AT4G15970

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.775

Rank 1 · TkA06G033230 · TK1151

Endoplasmic reticulum0.081

Rank 2 · TkA06G033230 · TK1151

Cytoplasm0.065

Rank 3 · TkA06G033230 · TK1151

Cell membrane0.058

Rank 4 · TkA06G033230 · TK1151

Lysosome / Vacuole0.043

Rank 5 · TkA06G033230 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03407Nucleotid_trans133-332 aa

PF04706Dickkopf_N301-324 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G033230	`PF03407`	Nucleotid_trans	133	332	3.7e-72	243.4
TkA06G033230	`PF04706`	Dickkopf_N	301	324	0.074	14.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P0C042`	Arabidopsis thaliana	sp\|P0C042\|Y4597_ARATH Uncharacterized protein At4g15970	55.300%	Swiss-Prot	High
`Q3E6Y3`	Arabidopsis thaliana	sp\|Q3E6Y3\|Y1869_ARATH Uncharacterized protein At1g28695	39.900%	Swiss-Prot	Medium
`Q9FXA7`	Arabidopsis thaliana	sp\|Q9FXA7\|RGXT3_ARATH UDP-D-xylose:L-fucose alpha-1,3-D-xylosyltransferase 3	26.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card