LXL04_025875 | RubberDandelionOmics

Gene overview

LXL04_025875

Reference: OH-1004 Chr: Chr05 Coordinates: 118018133-118021078 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1155 bp · LXL04_025875|LXL04_025875|OH1004|cDNA

ATGGGATTAGAAACTGGAAACAACACGGCGGTCGCCGGTCATCAACATGGCATATCTCCACCACCGGAGTCCACAccccaccaccacctccacctcctTCCCCCTTCCTCTAGTTTCCTCCTACAAACTCCAAAAGTGGTGATCATCTTTGCTATGATGGCATTTTCATGCTTGCTTCTTTATCGTGCTTCTCCTTCTGTATGGTTTCCGATCAGCTATAATTCTTTCGGTACCAATTCAGAGAACAAAGCAGATGACTT...

CDS

Download CDS FASTA

1155 bp · LXL04_025875|LXL04_025875|OH1004|CDS

ATGGGATTAGAAACTGGAAACAACACGGCGGTCGCCGGTCATCAACATGGCATATCTCCACCACCGGAGTCCACACCCCACCACCACCTCCACCTCCTTCCCCCTTCCTCTAGTTTCCTCCTACAAACTCCAAAAGTGGTGATCATCTTTGCTATGATGGCATTTTCATGCTTGCTTCTTTATCGTGCTTCTCCTTCTGTATGGTTTCCGATCAGCTATAATTCTTTCGGTACCAATTCAGAGAACAAAGCAGATGACTT...

Protein

Download Protein FASTA

384 aa · LXL04_025875|LXL04_025875|OH1004|PROTEIN

MGLETGNNTAVAGHQHGISPPPESTPHHHLHLLPPSSSFLLQTPKVVIIFAMMAFSCLLLYRASPSVWFPISYNSFGTNSENKADDLKNILIKAATSDNTVILTTLNDAWAEPNSMFDIFLESFQIGNQTQRFLNHLVVIAMDQKAYARCLKLHPHCYNLGTNGMDFSEEAYFMAPDYLKMMWRRIDFLHTILDLGYNFLFTDADIMWFRDPFPHFHEDGDFQIACDYFRGNPIDLNNLPNGGFTYVKSNSKTIQFYKYW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025875`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025875

Location Chr05:118018133-118021078 (+)

Description Similar to At4g15970: Uncharacterized protein At4g15970

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g15970`	Uncharacterized protein At4g15970.	No verified direct reference in this release
`At1g28695`	Uncharacterized protein At1g28695.	No verified direct reference in this release
`At1g56550`	Catalyzes the transfer of D-xylose from UDP-alpha-D-xylose onto L-fucose.	Functional characterisation of a putative rhamnogalacturonan II specific xylosyltransferase.2008 · DOI: 10.1016/j.febslet.2008.08.015
`At1g70630`	Beta-arabinofuranosyltransferase that transfers specifically an arabinosyl residue from UDP-arabinofuranose to the monosaccharide galactose or beta-methyl-galactoside in vitro.	No verified direct reference in this release
`At4g01220`	Catalyzes the transfer of D-xylose from UDP-alpha-D-xylose onto L-fucose.	Male gametophyte defective 4 encodes a rhamnogalacturonan II xylosyltransferase and is important for growth of pollen tubes and roots in Arabidopsis.2011 · DOI: 10.1111/j.1365-313x.2010.04452.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025875 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010306 rhamnogalacturonan II biosynthetic process Biological Process

GO:0042546 cell wall biogenesis Biological Process

GO:0048868 pollen tube development Biological Process

GO:0071555 cell wall organization Biological Process

GO:0000138 Golgi trans cisterna Cellular Component

GO:0000139 Golgi membrane Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016757 glycosyltransferase activity Molecular Function

GO:0035252 UDP-xylosyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G28695

ath:AT1G56550

ath:AT1G70630

ath:AT4G01220

ath:AT4G15970

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.776

Rank 1 · LXL04_025875 · OH-1004

Endoplasmic reticulum0.081

Rank 2 · LXL04_025875 · OH-1004

Cytoplasm0.065

Rank 3 · LXL04_025875 · OH-1004

Cell membrane0.058

Rank 4 · LXL04_025875 · OH-1004

Lysosome / Vacuole0.043

Rank 5 · LXL04_025875 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03407.23Nucleotid_trans133-332 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025875	`PF03407.23`	Nucleotid_trans	133	332	3.4e-72	243.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P0C042`	Arabidopsis thaliana	Uncharacterized protein At4g15970	53.608%	Swiss-Prot	strong database homology
`Q3E6Y3`	Arabidopsis thaliana	Uncharacterized protein At1g28695	40.942%	Swiss-Prot	moderate database homology
`Q9FXA7`	Arabidopsis thaliana	UDP-D-xylose:L-fucose alpha-1,3-D-xylosyltransferase 3	26.554%	Swiss-Prot	weak database homology
`F4I6V0`	Arabidopsis thaliana	Beta-arabinofuranosyltransferase RAY1	23.377%	Swiss-Prot	weak database homology
`Q9M146`	Arabidopsis thaliana	UDP-D-xylose:L-fucose alpha-1,3-D-xylosyltransferase MGP4	24.180%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card