TkA06G016170 | RubberDandelionOmics

Gene overview

TkA06G016170

Reference: TK1151 Chr: Chr06 Coordinates: 4375402-4379588 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1735 bp · TkA06G016170|TK1151|cDNA

GAAAATGAAACGAACCTTTGCATCAAAAGACAACGAAGTAAGTAATCTCATGCGTAGTTGCAGGAAGAGGACCATCGTCTCTTTCATACTCCCACATCGCTGTCCTCTTTTCTCTCCCGTTAAAATCCAGTGAGTTAGTGGAAGGGCTACTCTGGTTTCCGAAAAGCGTGATTTCTAGGGTCTCTATATATATAGCCACTGTGATCTTTCTTTTTGTTGCTGACAATCTCTGTTTACTGCTAATCGTACTATTTCGCTAT...

CDS

Download CDS FASTA

1002 bp · TkA06G016170|TK1151|CDS

ATGCTGGAAACGTTAAAGTACTTGATCGGCTCCGCCGGACCGAGCGGCTATGGTTCGAAATCGACCGCCGAACAAGTCACCGAGAATCGCGTCGATTTACGGTCCTCCACCGCCATTATCACCGGTGCGACGTCCGGAATCGGAGCTGAGACGGCTCGAGTTCTGGCTAAGCGCGGCGCTCGTCTCGTCATTCCTGCTCGAAACCTGAAAGCGGCGGAGGAAACAAAGGATCGTATCACATCGGAGTTTCCTGATTCGAA...

Protein

Download Protein FASTA

333 aa · TkA06G016170|TK1151|PROTEIN

MLETLKYLIGSAGPSGYGSKSTAEQVTENRVDLRSSTAIITGATSGIGAETARVLAKRGARLVIPARNLKAAEETKDRITSEFPDSKIIVMRLDLSSLKSVRSFVSDFEALNLPLNLLINNAGKFAHDHGISEDGIELTFATNYLGHFLLTKLLLRKMIATAKATGVQGRIVNVSSGIHTWFSGDIVGSLGQLTRDKSHYDATRAYAISKLANVLHTKELARRLQEMDCNVTVNCVHPGIVRTGLTREHEGFITDFVFFV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G016170`
TK1151 ID	TkA06G016170
OH-1004 ID	LXL04_009512
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	55.900
Protein coverage (%)	TK1151 96.396 / OH-1004 89.136 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G016170

Location Chr06:4375402-4379588 (+)

Description Similar to TIC32B: Short-chain dehydrogenase TIC 32 B, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g23430`	Involved in protein precursor import into chloroplasts.	Tic32, an essential component in chloroplast biogenesis.2004 · DOI: 10.1074/jbc.m402817200

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009512 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0015031 protein transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005765 lysosomal membrane Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009706 chloroplast inner membrane Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT4G23430

bna:106397857

hsa:57665

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.305

Rank 1 · TkA06G016170 · TK1151

Cytoplasm0.253

Rank 2 · TkA06G016170 · TK1151

Endoplasmic reticulum0.194

Rank 3 · TkA06G016170 · TK1151

Peroxisome0.165

Rank 4 · TkA06G016170 · TK1151

Nucleus0.100

Rank 5 · TkA06G016170 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23441SDR33-93 aa

PF00106adh_short37-177 aa

PF08659KR37-126 aa

PF01370Epimerase39-224 aa

PF13561adh_short_C242-257 aa

PF13460NAD_binding_1042-179 aa

PF00106adh_short199-248 aa

PF08659KR216-233 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G016170	`PF23441`	SDR	33	93	0.011	15.8
TkA06G016170	`PF00106`	adh_short	37	177	1.7e-34	119.7
TkA06G016170	`PF08659`	KR	37	126	2.6e-09	38.0
TkA06G016170	`PF01370`	Epimerase	39	224	4.2e-06	27.1
TkA06G016170	`PF13561`	adh_short_C2	42	257	6.9e-21	75.6
TkA06G016170	`PF13460`	NAD_binding_10	42	179	0.044	14.4
TkA06G016170	`PF00106`	adh_short	199	248	1.7e-34	119.7
TkA06G016170	`PF08659`	KR	216	233	2.6e-09	38.0
TkA06G016170	`PF23441`	SDR	220	246	0.011	15.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`A2RVM0`	Arabidopsis thaliana	sp\|A2RVM0\|TIC32_ARATH Short-chain dehydrogenase TIC 32, chloroplastic	47.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card