TkA06G001030 | RubberDandelionOmics

Gene overview

TkA06G001030

Reference: TK1151 Chr: Chr06 Coordinates: 229143-232807 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2569 bp · TkA06G001030|TK1151|cDNA

CAAAAACAGAACTGGAAACCCGAAGTGATCCGGGCTAAACCCGGGTTTAGACGTAAACCTCGGTGGTTGAAACCCGCTGACAGAAATGCGGTGTCAACTCCAAGCCCTAGTTAGTACGGTCGCCGGCGGTAGCATCCTCCAAGCAAAGCCCCAGGTCGGACAATGAGCAGTAAGTCAACCGGTCTTATGTTCCAGCTGAAGGTCGATCCGCTCACCGGTAAGTCGGAGTGGGTAGTGATTGAAGAAGAAGCGGATGATAT...

CDS

Download CDS FASTA

1995 bp · TkA06G001030|TK1151|CDS

ATGAGCAGTAAGTCAACCGGTCTTATGTTCCAGCTGAAGGTCGATCCGCTCACCGGTAAGTCGGAGTGGGTAGTGATTGAAGAAGAAGCGGATGATATATCGCCTAAACCAATGCTGGCTAGCACTTGTTACCTCGACATGCTCAATGATGCTCCAAGAAACAGAGCATATCGAGACGCCATCGATAGAAGTGTATCGAAACATTGCCATGTTTTGGATATCGGATCAGGAACGGGGTTGCTATCGATGATGGCTGCACG...

Protein

Download Protein FASTA

664 aa · TkA06G001030|TK1151|PROTEIN

MSSKSTGLMFQLKVDPLTGKSEWVVIEEEADDISPKPMLASTCYLDMLNDAPRNRAYRDAIDRSVSKHCHVLDIGSGTGLLSMMAARAMGKAGSVTACESYLPMVKLMKKVLRANDMLDANIRVINKRSDELQVGVDIASRAHVLVSEILDSELLGEGLIPSLQHACDNLLVENYQTVPYRATTYGQLVESSWLWKLHDLFNHEATTADGVGLLPKGKESLLQVKPQQLPMHCDALAQDIRLLSEPFKIFEFEFWKRPHS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G001030`
TK1151 ID	TkA06G001030
OH-1004 ID	LXL04_026601
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G001030

Location Chr06:229143-232807 (-)

Description Similar to PRMT7: Protein arginine N-methyltransferase 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g16570`	Arginine methyltransferase that can both catalyze the formation of omega-N monomethylarginine (MMA) and symmetrical dimethylarginine (sDMA).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2Y8B9`	Arginine methyltransferase that can both catalyze the formation of omega-N monomethylarginine (MMA) and symmetrical dimethylarginine (sDMA).	No verified direct reference in this release
`Os06g0105500`	Arginine methyltransferase that can both catalyze the formation of omega-N monomethylarginine (MMA) and symmetrical dimethylarginine (sDMA).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026601 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000387 spliceosomal snRNP assembly Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0018216 peptidyl-arginine methylation Biological Process

GO:0032259 methylation Biological Process

GO:0071514 genomic imprinting Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016274 protein-arginine N-methyltransferase activity Molecular Function

GO:0035241 protein-arginine omega-N monomethyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT4G16570

dan:6494167

dosa:Os06g0105500

xla:379700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.540

Rank 1 · TkA06G001030 · TK1151

Nucleus0.424

Rank 2 · TkA06G001030 · TK1151

Mitochondrion0.130

Rank 3 · TkA06G001030 · TK1151

Cell membrane0.063

Rank 4 · TkA06G001030 · TK1151

Endoplasmic reticulum0.045

Rank 5 · TkA06G001030 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02475TRM5-TYW2_MTfase52-133 aa

PF06325PrmA60-152 aa

PF10294Methyltransf_1661-124 aa

PF01135PCMT65-121 aa

PF00398RrnaAD65-131 aa

PF13847Methyltransf_3166-123 aa

PF01209Ubie_methyltran66-133 aa

PF05175MTS68-126 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G001030	`PF02475`	TRM5-TYW2_MTfase	52	133	0.03	15.0
TkA06G001030	`PF06325`	PrmA	60	152	0.00052	20.3
TkA06G001030	`PF10294`	Methyltransf_16	61	124	0.00082	19.9
TkA06G001030	`PF01135`	PCMT	65	121	0.00084	19.9
TkA06G001030	`PF00398`	RrnaAD	65	131	0.016	15.1
TkA06G001030	`PF13847`	Methyltransf_31	66	123	0.0023	18.4
TkA06G001030	`PF01209`	Ubie_methyltran	66	133	0.26	11.3
TkA06G001030	`PF05175`	MTS	68	126	0.00034	21.0
TkA06G001030	`PF13649`	Methyltransf_25	71	133	5.6e-05	24.5
TkA06G001030	`PF22528`	PRMT_C	241	343	2.9e-19	70.3
TkA06G001030	`PF02475`	TRM5-TYW2_MTfase	406	422	0.03	15.0
TkA06G001030	`PF06325`	PrmA	437	461	0.00052	20.3
TkA06G001030	`PF22528`	PRMT_C	560	648	2.9e-19	70.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q944R7`	Arabidopsis thaliana	sp\|Q944R7\|ANM16_ARATH Protein arginine N-methyltransferase 1.6	55.200%	Swiss-Prot	High
`A2Y8B9`	Oryza sativa subsp. indica	sp\|A2Y8B9\|ANM7_ORYSI Protein arginine N-methyltransferase 7	54.500%	Swiss-Prot	High
`Q5VS72`	Oryza sativa subsp. japonica	sp\|Q5VS72\|ANM7_ORYSJ Protein arginine N-methyltransferase 7	54.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card