LXL04_026601 | RubberDandelionOmics

Gene overview

LXL04_026601

Reference: OH-1004 Chr: Chr05 Coordinates: 129374022-129377101 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2007 bp · LXL04_026601|LXL04_026601|OH1004|cDNA

ATGAGCAGTAAGTCAACCGGTCTTATGTTCCAGCTGAAGGTCGATCCGCTCACCGGTAAGTCGGAGTGGGTAGTGATTGAAGAAGAAGCGGATGATATATCGCCTAAACCAATGCTGGCTAGCACTTGTTACCTCGACATGCTCAATGATGCTCCAAGAAACAGAGCATATCGAGACGCCATCGATAGAAGTGTATCGAAACATTGCCATGTTTTGGATATCGGATCAGGAACGGGGTTGCTATCGATGATGGCTGCACG...

CDS

Download CDS FASTA

2007 bp · LXL04_026601|LXL04_026601|OH1004|CDS

ATGAGCAGTAAGTCAACCGGTCTTATGTTCCAGCTGAAGGTCGATCCGCTCACCGGTAAGTCGGAGTGGGTAGTGATTGAAGAAGAAGCGGATGATATATCGCCTAAACCAATGCTGGCTAGCACTTGTTACCTCGACATGCTCAATGATGCTCCAAGAAACAGAGCATATCGAGACGCCATCGATAGAAGTGTATCGAAACATTGCCATGTTTTGGATATCGGATCAGGAACGGGGTTGCTATCGATGATGGCTGCACG...

Protein

Download Protein FASTA

668 aa · LXL04_026601|LXL04_026601|OH1004|PROTEIN

MSSKSTGLMFQLKVDPLTGKSEWVVIEEEADDISPKPMLASTCYLDMLNDAPRNRAYRDAIDRSVSKHCHVLDIGSGTGLLSMMAARAMGKAGSVTACESYLPMVKLMKKVLRANDMLDANIRVINKRSDELQVGVDIASRAHVLVSEILDSELLGEGLIPSLQHACDNLLVENYQTVPYRATTYGQLVESSWLWKLHDLFNHEATTADGVGLLPKGKESLLQVKPQQLPMHCDALAQDIRLTSIQLSEPFKIFEFEFWK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026601`
TK1151 ID	TkA06G001030
OH-1004 ID	LXL04_026601
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026601

Location Chr05:129374022-129377101 (+)

Description Similar to PRMT7: Protein arginine N-methyltransferase 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g16570`	Arginine methyltransferase that can both catalyze the formation of omega-N monomethylarginine (MMA) and symmetrical dimethylarginine (sDMA).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2Y8B9`	Arginine methyltransferase that can both catalyze the formation of omega-N monomethylarginine (MMA) and symmetrical dimethylarginine (sDMA).	No verified direct reference in this release
`Os06g0105500`	Arginine methyltransferase that can both catalyze the formation of omega-N monomethylarginine (MMA) and symmetrical dimethylarginine (sDMA).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026601 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000387 spliceosomal snRNP assembly Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0018216 peptidyl-arginine methylation Biological Process

GO:0032259 methylation Biological Process

GO:0071514 genomic imprinting Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016274 protein-arginine N-methyltransferase activity Molecular Function

GO:0035241 protein-arginine omega-N monomethyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT4G16570

dan:6494167

dosa:Os06g0105500

xla:379700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.537

Rank 1 · LXL04_026601 · OH-1004

Nucleus0.429

Rank 2 · LXL04_026601 · OH-1004

Mitochondrion0.127

Rank 3 · LXL04_026601 · OH-1004

Cell membrane0.062

Rank 4 · LXL04_026601 · OH-1004

Endoplasmic reticulum0.045

Rank 5 · LXL04_026601 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22528.2PRMT_C247-349 aa

PF22528.2PRMT_C564-652 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026601	`PF22528.2`	PRMT_C	247	349	6.2e-19	69.2
LXL04_026601	`PF22528.2`	PRMT_C	564	652	6.2e-19	69.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q944R7`	Arabidopsis thaliana	Protein arginine N-methyltransferase 1.6	54.714%	Swiss-Prot	strong database homology
`A2Y8B9`	Oryza sativa subsp. indica	Protein arginine N-methyltransferase 7	54.245%	Swiss-Prot	strong database homology
`Q5VS72`	Oryza sativa subsp. japonica	Protein arginine N-methyltransferase 7	54.101%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card