TkA05G464860 | RubberDandelionOmics

Gene overview

TkA05G464860

Reference: TK1151 Chr: Chr05 Coordinates: 116468089-116469377 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1121 bp · TkA05G464860|TK1151|cDNA

ATCCCCTAACTGTTAAGTCAAACGAAAATAGGTTCATTCCAGAAGTACTCGGACCTCAAATCTGTTCACTACGGTATACACACAGACCCCCTTCTTGAAGCCCTACACCAATCTCCCATTTCTCTCGGAACTCCCATCGACCTATAGCACCAATGCATCGCCATTTGAGCAAGCTTTGGGGCGGGGTTGCTGCAGCAAGGCCGACTATAAACCATCAATGGCGGTCATACGGTCTAATACCCATGGTGATTGAGCATTCG...

CDS

Download CDS FASTA

705 bp · TkA05G464860|TK1151|CDS

ATGCATCGCCATTTGAGCAAGCTTTGGGGCGGGGTTGCTGCAGCAAGGCCGACTATAAACCATCAATGGCGGTCATACGGTCTAATACCCATGGTGATTGAGCATTCGTCGCGAGGAGAGAGAGCATACGACATCTTCTCCAGACTCCTCAAAGAAAGGATTATCTGTATTAACGGTCCTATTTCCGATGACACATCACACGTCGTCGTAGCTCAGCTTCTCTTCCTCGAATCGGAAAACCCCTCTAAACCCATCAACAT...

Protein

Download Protein FASTA

234 aa · TkA05G464860|TK1151|PROTEIN

MHRHLSKLWGGVAAARPTINHQWRSYGLIPMVIEHSSRGERAYDIFSRLLKERIICINGPISDDTSHVVVAQLLFLESENPSKPINMYLNSPGGAVTAGLAIYDTMQYIRSPINTICLGQAASMASLLLAAGAKGERRALPNATIMIHQPSGGYSGQAKDISIHTKEIMRIWESLNGLYAKHTGQNVDVIQKNMDRDYFMTPQEAKEFGIIDEVIEERPLTLVTDAVGSEKKLD

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G464860`
TK1151 ID	TkA05G464860
OH-1004 ID	LXL04_025640
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	87.400
Protein coverage (%)	TK1151 98.291 / OH-1004 95.417 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G464860

Location Chr05:116468089-116469377 (-)

Description Similar to CLPP2: ATP-dependent Clp protease proteolytic subunit 2, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g23140`	Component of the mitochondrial ATP-dependent Clp protease.	Plant mitochondria contain proteolytic and regulatory subunits of the ATP-dependent Clp protease.2001 · DOI: 10.1023/a:1010677220323

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025640 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006515 protein quality control for misfolded or incompletely synthesized proteins Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009368 endopeptidase Clp complex Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009532 plastid stroma Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009840 chloroplastic endopeptidase Clp complex Cellular Component

KEGG gene cross-reference

ath:AT5G23140

bbk:BARBAKC583_0546

bhe:BH05880

bqu:BQ05040

btr:BT_0876

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.950

Rank 1 · TkA05G464860 · TK1151

Cytoplasm0.049

Rank 2 · TkA05G464860 · TK1151

Nucleus0.047

Rank 3 · TkA05G464860 · TK1151

Cell membrane0.023

Rank 4 · TkA05G464860 · TK1151

Plastid0.016

Rank 5 · TkA05G464860 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00574CLP_protease38-217 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G464860	`PF00574`	CLP_protease	38	217	1.6e-82	276.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FN42`	Arabidopsis thaliana	sp\|Q9FN42\|CLPP2_ARATH ATP-dependent Clp protease proteolytic subunit 2, mitochondrial	85.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card