TkA05G457660 | RubberDandelionOmics

Gene overview

TkA05G457660

Reference: TK1151 Chr: Chr05 Coordinates: 114658792-114660128 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1174 bp · TkA05G457660|TK1151|cDNA

TTAAACCCCTCTCTGCATTCTCTACTTGCAGATTTACATGTGATGCTGTTGGGTTGGTCCTTATTTAAGCACCTCCTAATCGAATCCTCTATTCCCATCTTCTTCCCCATTTCCTTAATCTCTTCCCCAATTCAAAAATGGCCAAAATTTCCTTCATTTTGCTAGCTTCTATCTACTCCCTTTTCCTTCATGCCCAAGCTTTCACCCCTTCCAGATGGGCGAAAGCCCATGCAACCTTTTATGGAAACGCCGATGCTTCC...

CDS

Download CDS FASTA

762 bp · TkA05G457660|TK1151|CDS

ATGGCCAAAATTTCCTTCATTTTGCTAGCTTCTATCTACTCCCTTTTCCTTCATGCCCAAGCTTTCACCCCTTCCAGATGGGCGAAAGCCCATGCAACCTTTTATGGAAACGCCGATGCTTCCGGAACAATGGGTGGTGCTTGTGGATATGGTAATTTGTATTCCACCGGATACGGTACAAGAACCGCCGCATTGAGTACTGCTCTTTTCAACGACGGCGCTGCGTGCGGCCAGTGTTACAAGATCATATGCGATTACAA...

Protein

Download Protein FASTA

253 aa · TkA05G457660|TK1151|PROTEIN

MAKISFILLASIYSLFLHAQAFTPSRWAKAHATFYGNADASGTMGGACGYGNLYSTGYGTRTAALSTALFNDGAACGQCYKIICDYKTDPKWCKKGVSVTITATNFCPPNYAQANDAGGWCNPPLQHFDMAQPAWEKIGIYRGGIIPVIYQRVPCKKHGGVRFTINGRNYFELVLVTNVGGAGAVRSMKVKGSKTGWMPMSRNWGANWQSNSYLNGQSLSFMVTTNDGVTKTFTNIVPAGWSFGQTFSSRLQF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G457660`
TK1151 ID	TkA05G457660
OH-1004 ID	LXL04_022301
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G457660

Location Chr05:114658792-114660128 (+)

Description Similar to EXPA1: Expansin-A1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g20190`	Causes loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0228400`	May cause loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release
`Os02g0267200`	May cause loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release
`Os02g0268000`	May cause loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release
`Os06g0718100`	May cause loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022301 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009826 unidimensional cell growth Biological Process

GO:0009828 plant-type cell wall loosening Biological Process

GO:0005576 extracellular region Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT1G20190

dosa:Os02g0267200

dosa:Os04g0228400

dosa:Os06g0718100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.815

Rank 1 · TkA05G457660 · TK1151

Cytoplasm0.073

Rank 2 · TkA05G457660 · TK1151

Lysosome / Vacuole0.047

Rank 3 · TkA05G457660 · TK1151

Endoplasmic reticulum0.037

Rank 4 · TkA05G457660 · TK1151

Cell membrane0.024

Rank 5 · TkA05G457660 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29515Expansin_N19-110 aa

PF03330DPBB_130-43 aa

PF22514EXPB1_D131-158 aa

PF03330DPBB_162-150 aa

PF06865Ppnp159-173 aa

PF01357Expansin_C161-238 aa

PF06865Ppnp209-245 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G457660	`PF29515`	Expansin_N	19	110	1.6e-09	38.7
TkA05G457660	`PF03330`	DPBB_1	30	43	1.6e-21	77.0
TkA05G457660	`PF22514`	EXPB1_D1	31	158	1.8e-07	32.3
TkA05G457660	`PF03330`	DPBB_1	62	150	1.6e-21	77.0
TkA05G457660	`PF06865`	Ppnp	159	173	0.075	14.1
TkA05G457660	`PF01357`	Expansin_C	161	238	1.3e-29	102.8
TkA05G457660	`PF06865`	Ppnp	209	245	0.075	14.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LNU3`	Arabidopsis thaliana	sp\|Q9LNU3\|EXP11_ARATH Expansin-A11	70.200%	Swiss-Prot	High
`Q7XWU8`	Oryza sativa subsp. japonica	sp\|Q7XWU8\|EXPA1_ORYSJ Expansin-A1	71.400%	Swiss-Prot	High
`Q4PR52`	Oryza sativa subsp. japonica	sp\|Q4PR52\|EXP13_ORYSJ Expansin-A13	73.900%	Swiss-Prot	High
`Q4PR43`	Oryza sativa subsp. japonica	sp\|Q4PR43\|EXP23_ORYSJ Expansin-A23	74.000%	Swiss-Prot	High
`Q4PR39`	Oryza sativa subsp. japonica	sp\|Q4PR39\|EXP29_ORYSJ Expansin-A29	66.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card