RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA05G448720
Reference: TK1151 Chr: Chr05 Coordinates: 112171807-112177025 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

4091 bp · TkA05G448720|TK1151|cDNA

CCATAAGCCTCGTTTGTGAACGAATAAAACCCTAATTTCCACTCCATTTCATTTCTCCTTTCTCTCTCCACCTCCCACATTCTCTCTCCCAACGCAATTAATCTCTTCGACAGCTACAGCTTCTCCTATGGCGACGGCGGGCGAGGGAAGGGCTCCCTACGAAAGCAGTGGAGCCGGAGGAAAGCTCCGTAAGAGGCCTTTCCGGCGTAGTGCTCCGGCGACGCCGTATGATCGACCTGCTACCGCGCTCAGGAACAACA...

CDS

Download CDS FASTA

2865 bp · TkA05G448720|TK1151|CDS

ATGTACAGCATGGCAAGAACACCGTATTCCAGAAGCCCTAACCAAAACACCGGTCATGGTACATCATTAAAAAGAAGGAGTTCTGTTTTAGAAGATGATTTTGGATCCGTGGGCCCACTTCGTAGGACCCGACAAAAACCCAATCTTATGTTACAATCCAAAAAAGAACTCGGGTACACTATTTCCCAACAACCAATGCTTTTAAAAAACAAACCTGAAGAAAACGGTGACACCATCATGTCAAAGTCAAAGTCAACCCA...

Protein

Download Protein FASTA

954 aa · TkA05G448720|TK1151|PROTEIN

MYSMARTPYSRSPNQNTGHGTSLKRRSSVLEDDFGSVGPLRRTRQKPNLMLQSKKELGYTISQQPMLLKNKPEENGDTIMSKSKSTHVSVPEKSTQTAMKIFQQLESLTPKSPTKLTSNMLNGQALRSLEKVDSVKYLQTSQCNGESASTSRGKEKVEENRSRKFPVPFNMLTTSTTGNGDVAVLKESAQAVAIDDDDDESALKLPPEPPQKKRAFQMSAPEIDDDDDDIIHVNGHVSFPPVENNNKLESSPVVNKPVTA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA05G448720
TK1151 IDTkA05G448720
OH-1004 IDLXL04_022168
Relationship / confidenceRbh Sequence Supported / Probable
Protein identity (%)97.700
Protein coverage (%)TK1151 99.895 / OH-1004 73.410
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA05G448720
LocationChr05:112171807-112177025 (-)
DescriptionSimilar to NUP1: Nuclear pore complex protein NUP1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g10650 Nucleoporin required for nuclear mRNA export.
Arabidopsis homolog of the yeast TREX-2 mRNA export complex: components and anchoring nucleoporin.2010 · DOI: 10.1111/j.1365-313x.2009.04048.x
Identification and characterization of nuclear pore complex components in Arabidopsis thaliana.2010 · DOI: 10.1105/tpc.110.079947
Involvement of the nuclear pore complex in morphology of the plant nucleus.2011 · DOI: 10.4161/nucl.2.3.16175

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_022168 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006997 nucleus organization Biological Process
GO:0015031 protein transport Biological Process
GO:0016973 poly(A)+ mRNA export from nucleus Biological Process
GO:0071763 nuclear membrane organization Biological Process
GO:0005634 nucleus Cellular Component
GO:0005635 nuclear envelope Cellular Component
GO:0005643 nuclear pore Cellular Component
GO:0005829 cytosol Cellular Component
GO:0034399 nuclear periphery Cellular Component
KEGG gene cross-reference
ath:AT3G10650
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.956
Rank 1 · TkA05G448720 · TK1151
Cytoplasm0.127
Rank 2 · TkA05G448720 · TK1151
Cell membrane0.019
Rank 3 · TkA05G448720 · TK1151
Mitochondrion0.015
Rank 4 · TkA05G448720 · TK1151
Endoplasmic reticulum0.011
Rank 5 · TkA05G448720 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9CAF4Arabidopsis thalianasp|Q9CAF4|NUP1_ARATH Nuclear pore complex protein NUP139.500%Swiss-ProtLow

JBrowse

View in Genome Browser