TkA05G445620 | RubberDandelionOmics

Gene overview

TkA05G445620

Reference: TK1151 Chr: Chr05 Coordinates: 111467238-111471375 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2284 bp · TkA05G445620|TK1151|cDNA

GAATTTTCATGCTTTTTAGGCATCCATCAAATTACCACGTGTCCCTGTTCTCTCTCTACCCTTCTTTCTCGCTCTAACTTTGTTCCCTCCATCCCTCCCCTTTGTAGAACAAATTATTGACAAAAAACCAAAAAAGTGATGAAAAATAGAAGGATACATCGATAAAAAAACGAATTCCCCATCATTTACTCAAATGGGTCTTCTTTCTCATCTTCAATCTCCATCTTTCCCCTTCAATTTTGCTTTTTAGGGTTTTGAAT...

CDS

Download CDS FASTA

1512 bp · TkA05G445620|TK1151|CDS

ATGATGGCAATACTTGGGGGCGAAATGGAGAAGGATATTGAATCGAAGCTACATATCCAGGACAATTCAGCTAACCGCGGGGGCGGCAAAGATATTAACAAATCTAGTAGCTTTAAATTTAGGGCACCACAAGAGAATTTCACCATCCAGGATTTCGAAATGGGGAAGATCTATGGTGTTGGTTCTTATTCAAAGGTTGTAAGAGCAAGAAAGAAAGATACAGGAAAAGTGTATGCTTTAAAGATCATGGATAAAAAATT...

Protein

Download Protein FASTA

503 aa · TkA05G445620|TK1151|PROTEIN

MMAILGGEMEKDIESKLHIQDNSANRGGGKDINKSSSFKFRAPQENFTIQDFEMGKIYGVGSYSKVVRARKKDTGKVYALKIMDKKFITKENKTAYVKLERIVLDQLTHPGIVQLHFTFQDTFSLYMALESCEGGELFDQITRKGRLTEDEARFYAAEVIDALEYIHNLGLIHRDIKPENLLLTSDGHIKIADFGSVKPMQDSQITVLPNAASDDKACTFVGTAAYVPPEVLNSSPATIGNDLWALGCTLFQMLSGTSPF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G445620`
TK1151 ID	TkA05G445620
OH-1004 ID	LXL04_035944
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	36.500
Protein coverage (%)	TK1151 56.064 / OH-1004 57.537 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G445620

Location Chr05:111467238-111471375 (+)

Description Similar to ATPK2: Serine/threonine-protein kinase AtPK2/AtPK19

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g10540`	3-phosphoinositide-dependent protein kinase 2.	No verified direct reference in this release
`At5g04510`	May couple lipid signals to the activation-loop phosphorylation of several protein kinases of the so-called AGC kinase family.	Characterisation of a plant 3-phosphoinositide-dependent protein kinase-1 homologue which contains a pleckstrin homology domain.1999 · DOI: 10.1016/s0014-5793(99)00556-6 A protein kinase target of a PDK1 signalling pathway is involved in root hair growth in Arabidopsis.2004 · DOI: 10.1038/sj.emboj.7600068 Arabidopsis TARGET OF RAPAMYCIN interacts with RAPTOR, which regulates the activity of S6 kinase in response to osmotic stress signals.2006 · DOI: 10.1105/tpc.105.035931 Phosphorylation and activation of PINOID by the phospholipid signaling kinase 3-phosphoinositide-dependent protein kinase 1 (PDK1) in Arabidopsis.2006 · DOI: 10.1073/pnas.0510283103 Structural and functional insights into the regulation of Arabidopsis AGC VIIIa kinases.2006 · DOI: 10.1074/jbc.m605167200

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035944 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000281 mitotic cytokinesis Biological Process

GO:0006468 protein phosphorylation Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0007163 establishment or maintenance of cell polarity Biological Process

GO:0008285 negative regulation of cell population proliferation Biological Process

GO:0009408 response to heat Biological Process

GO:0009409 response to cold Biological Process

GO:0009651 response to salt stress Biological Process

GO:0030010 establishment of cell polarity Biological Process

GO:0030011 maintenance of cell polarity Biological Process

GO:0030334 regulation of cell migration Biological Process

GO:0031036 myosin II filament assembly Biological Process

KEGG gene cross-reference

ath:AT3G08720

ath:AT3G08730

ddi:DDB_G0268620

ddi:DDB_G0277449

ddi:DDB_G0290157

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.689

Rank 1 · TkA05G445620 · TK1151

Nucleus0.281

Rank 2 · TkA05G445620 · TK1151

Cell membrane0.174

Rank 3 · TkA05G445620 · TK1151

Golgi apparatus0.066

Rank 4 · TkA05G445620 · TK1151

Lysosome / Vacuole0.060

Rank 5 · TkA05G445620 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase53-319 aa

PF07714PK_Tyr_Ser-Thr54-303 aa

PF14531Kinase-like59-102 aa

PF03109ABC159-84 aa

PF14531Kinase-like149-269 aa

PF01636APH157-189 aa

PF03109ABC1162-205 aa

PF14593PH_3400-502 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G445620	`PF00069`	Pkinase	53	319	3.4e-66	224.0
TkA05G445620	`PF07714`	PK_Tyr_Ser-Thr	54	303	1e-28	101.1
TkA05G445620	`PF14531`	Kinase-like	59	102	2.8e-08	34.1
TkA05G445620	`PF03109`	ABC1	59	84	0.0016	18.4
TkA05G445620	`PF14531`	Kinase-like	149	269	2.8e-08	34.1
TkA05G445620	`PF01636`	APH	157	189	0.078	13.4
TkA05G445620	`PF03109`	ABC1	162	205	0.0016	18.4
TkA05G445620	`PF14593`	PH_3	400	502	4.9e-29	101.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q4V3C8`	Arabidopsis thaliana	sp\|Q4V3C8\|PDPK2_ARATH 3-phosphoinositide-dependent protein kinase 2	76.200%	Swiss-Prot	High
`Q9XF67`	Arabidopsis thaliana	sp\|Q9XF67\|PDPK1_ARATH 3-phosphoinositide-dependent protein kinase 1	72.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card