TkA05G438480 | RubberDandelionOmics

Gene overview

TkA05G438480

Reference: TK1151 Chr: Chr05 Coordinates: 109469741-109471624 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1680 bp · TkA05G438480|TK1151|cDNA

ATGGCGATATCGGATCCGAGTAAGTGTATGTCTGATCAAATCGGGAATATGGAAAATTTCGATGATCGGAAAAGTGGAGGCGTTTATATCCCACCATTGAAATCGGCTCGTAAGATAAACGAATTTCAAGATAAAAGCAGCATTGAATATCAAAGAATCACATGGGACGCATTAAGGAAGAGCATAAACGGGCTGGTCAACAAAGTCAACGCCGCAAACATCAAGAACATCATCCCGGAGTTGTTTGCTGAAAATCTGAT...

CDS

Download CDS FASTA

1680 bp · TkA05G438480|TK1151|CDS

ATGGCGATATCGGATCCGAGTAAGTGTATGTCTGATCAAATCGGGAATATGGAAAATTTCGATGATCGGAAAAGTGGAGGCGTTTATATCCCACCATTGAAATCGGCTCGTAAGATAAACGAATTTCAAGATAAAAGCAGCATTGAATATCAAAGAATCACATGGGACGCATTAAGGAAGAGCATAAACGGGCTGGTCAACAAAGTCAACGCCGCAAACATCAAGAACATCATCCCGGAGTTGTTTGCTGAAAATCTGAT...

Protein

Download Protein FASTA

559 aa · TkA05G438480|TK1151|PROTEIN

MAISDPSKCMSDQIGNMENFDDRKSGGVYIPPLKSARKINEFQDKSSIEYQRITWDALRKSINGLVNKVNAANIKNIIPELFAENLIRGRGLFCRSLIKSQMASPNFTDVFAALVAVVNTKFPEVGDLLLRRTVLQLQRSYKKNDKPQLLAAVKFLAHLVNHQVVQELIALELLTILLENPTDDSVEVAVGFVTECGSILLDLSPKAFHGIFERFRGILHEGEIDKRVQFLIEGLFALRKAKFQGHPAVRPDLDIVEMED...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G438480`
TK1151 ID	TkA05G438480
OH-1004 ID	LXL04_022001
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 91.042 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G438480`
Location	Chr05:109469741-109471624 (-)
Description	Similar to CWC22: Pre-mRNA-splicing factor CWC22 (Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_022001` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000398 mRNA splicing, via spliceosome Biological Process GO:0045292 mRNA cis splicing, via spliceosome Biological Process GO:0000974 Prp19 complex Cellular Component GO:0005684 U2-type spliceosomal complex Cellular Component GO:0005737 cytoplasm Cellular Component GO:0016607 nuclear speck Cellular Component GO:0071013 catalytic step 2 spliceosome Cellular Component GO:0003723 RNA binding Molecular Function
KEGG gene cross-reference	afm:AFUA_1G03010 cnb:CNBF4440 cne:CNF00260 spo:2539941 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.631

Rank 1 · TkA05G438480 · TK1151

Nucleus0.404

Rank 2 · TkA05G438480 · TK1151

Cell membrane0.066

Rank 3 · TkA05G438480 · TK1151

Endoplasmic reticulum0.046

Rank 4 · TkA05G438480 · TK1151

Golgi apparatus0.045

Rank 5 · TkA05G438480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02854MIF4G60-241 aa

PF02847MA3335-439 aa

PF22922GAF_NLP371-424 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G438480	`PF02854`	MIF4G	60	241	1.6e-17	64.7
TkA05G438480	`PF02847`	MA3	335	439	6.7e-28	97.6
TkA05G438480	`PF22922`	GAF_NLP	371	424	0.15	12.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card