LXL04_022001 | RubberDandelionOmics

Gene overview

LXL04_022001

Reference: OH-1004 Chr: Chr04 Coordinates: 142262657-142265430 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1845 bp · LXL04_022001|LXL04_022001|OH1004|cDNA

ATGTCAAAGTTCCACGAACTGACCATCGTCGTTATCCTCTACTATGCTGCAATCTCCACCTGCCGATGTTGTCGGCTTCCTGACGAGAAGATAAAGAACGGAGGCGATCAACGCAAGAAGTTCCGGTTGTCGATCAACGCAATCGATAATCTCTTAGCAACTTGCATGGCGATATCGGATCCGAGTAAGTGTATGTCTGATCAAATCGGGAATAGGGAAAATTTCGATGATCGGAAAAGTGGAGGCGTTTATATCCCACC...

CDS

Download CDS FASTA

1845 bp · LXL04_022001|LXL04_022001|OH1004|CDS

ATGTCAAAGTTCCACGAACTGACCATCGTCGTTATCCTCTACTATGCTGCAATCTCCACCTGCCGATGTTGTCGGCTTCCTGACGAGAAGATAAAGAACGGAGGCGATCAACGCAAGAAGTTCCGGTTGTCGATCAACGCAATCGATAATCTCTTAGCAACTTGCATGGCGATATCGGATCCGAGTAAGTGTATGTCTGATCAAATCGGGAATAGGGAAAATTTCGATGATCGGAAAAGTGGAGGCGTTTATATCCCACC...

Protein

Download Protein FASTA

614 aa · LXL04_022001|LXL04_022001|OH1004|PROTEIN

MSKFHELTIVVILYYAAISTCRCCRLPDEKIKNGGDQRKKFRLSINAIDNLLATCMAISDPSKCMSDQIGNRENFDDRKSGGVYIPPLKSARKINEFQDKSSIEYQRITWDALRKSINGLVNKVNAANIKNIIPELFAENLIRGRGLFCRSLIKSQMASPNVTDVFAALVAVVNTKFPEVGDLLLRRTVLQLQRSYKKNDKPQLLAAVKFLAHLVNHQVVQELIALELLTILLENPTDDSVEVAVGFVTECGSILLDLSP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022001`
TK1151 ID	TkA05G438480
OH-1004 ID	LXL04_022001
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 91.042 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_022001`
Location	Chr04:142262657-142265430 (-)
Description	Similar to CWC22: Pre-mRNA-splicing factor CWC22 (Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_022001` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0000398 mRNA splicing, via spliceosome Biological Process GO:0045292 mRNA cis splicing, via spliceosome Biological Process GO:0000974 Prp19 complex Cellular Component GO:0005684 U2-type spliceosomal complex Cellular Component GO:0005737 cytoplasm Cellular Component GO:0016607 nuclear speck Cellular Component GO:0071013 catalytic step 2 spliceosome Cellular Component GO:0003723 RNA binding Molecular Function
KEGG gene cross-reference	afm:AFUA_1G03010 cnb:CNBF4440 cne:CNF00260 spo:2539941 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.603

Rank 1 · LXL04_022001 · OH-1004

Nucleus0.367

Rank 2 · LXL04_022001 · OH-1004

Cell membrane0.077

Rank 3 · LXL04_022001 · OH-1004

Golgi apparatus0.061

Rank 4 · LXL04_022001 · OH-1004

Endoplasmic reticulum0.060

Rank 5 · LXL04_022001 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02854.26MIF4G115-296 aa

PF02847.24MA3390-494 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022001	`PF02854.26`	MIF4G	115	296	1.6e-16	61.4
LXL04_022001	`PF02847.24`	MA3	390	494	2.7e-27	95.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card