TkA05G429360 | RubberDandelionOmics

Gene overview

TkA05G429360

Reference: TK1151 Chr: Chr05 Coordinates: 107089082-107093129 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1477 bp · TkA05G429360|TK1151|cDNA

TACCGTCGACATTCCACCCACCTAGCCCGCTCACCGACCCGGCTGCTTCCCTGATCTGCTGCTCTTGAACTGTAAACCAGACAAAATTTAGGTATTTCTTCGGCTCCATGAAATCTTAACTTGTAGTGTAAGTCTACTATCTCAACGGCCTCATCTGTCCTGCACCGATCTCGAAATTCTTTCACCGCGGCGCCATTTCAGAGTGATCTGCGGGATCGACTGATCGTGTACTGGCATTCCGAGAAGTTTTGGTCGTCGTT...

CDS

Download CDS FASTA

942 bp · TkA05G429360|TK1151|CDS

ATGGCTAAAGTTAGAGACAGAACCGAAGACTTCAAAGATGCTGTCAACAGGGGAGCTTTATCTTTAGGATTTAACGAGGCCAAAAGGGCAGCTCTAATGGCATCTTTCATCATGCACAAACCTCGTGAAAGATCACATTTTACCAAAGCTGCTTTAAAAACACTAGAAAGCATTGGGACTTTGGAACAGTTCTTGATAAAGCATAGAAAGGATTATGTAGATCCACATCGTACCACTGAAGAAGAAAGAGACAGCATTGA...

Protein

Download Protein FASTA

313 aa · TkA05G429360|TK1151|PROTEIN

MAKVRDRTEDFKDAVNRGALSLGFNEAKRAALMASFIMHKPRERSHFTKAALKTLESIGTLEQFLIKHRKDYVDPHRTTEEERDSIEHEVSVFVKACKEQIDILKTSITDEESNAKGWLGIRADNSNLDTIAHKHGVVLILSETLHSVTSQFDQLRAVRFQEAINRAMPRRKPKPKPKLEKTSSNNIESTSSSEMRDPGEITTEPLKLQQQQLLDDETRALQVELSSLLDAARDTETKMVEMSALNHLMSTHVLQQAQQI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G429360`
TK1151 ID	TkA05G429360
OH-1004 ID	LXL04_021884
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G429360

Location Chr05:107089082-107093129 (+)

Description Similar to SYP81: Syntaxin-81

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g51740`	Vesicle trafficking protein that functions in the secretory pathway.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021884 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum Biological Process

GO:0015031 protein transport Biological Process

GO:0090158 endoplasmic reticulum membrane organization Biological Process

GO:1902117 positive regulation of organelle assembly Biological Process

GO:1902953 positive regulation of ER to Golgi vesicle-mediated transport Biological Process

GO:1903358 regulation of Golgi organization Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

KEGG gene cross-reference

ath:AT1G51740

dre:554130

hsa:53407

pon:100441033

rno:360953

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.530

Rank 1 · TkA05G429360 · TK1151

Endoplasmic reticulum0.346

Rank 2 · TkA05G429360 · TK1151

Cytoplasm0.211

Rank 3 · TkA05G429360 · TK1151

Lysosome / Vacuole0.080

Rank 4 · TkA05G429360 · TK1151

Nucleus0.076

Rank 5 · TkA05G429360 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10496Syntaxin-18_N5-86 aa

PF16789YscO-like6-28 aa

PF12397U3snoRNP1025-71 aa

PF16789YscO-like65-89 aa

PF10496Syntaxin-18_N89-99 aa

PF05739SNARE90-114 aa

PF05739SNARE138-155 aa

PF10496Syntaxin-18_N160-185 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G429360	`PF10496`	Syntaxin-18_N	5	86	1.2e-17	64.7
TkA05G429360	`PF16789`	YscO-like	6	28	1.0	10.1
TkA05G429360	`PF12397`	U3snoRNP10	25	71	0.055	14.5
TkA05G429360	`PF16789`	YscO-like	65	89	1.0	10.1
TkA05G429360	`PF10496`	Syntaxin-18_N	89	99	1.2e-17	64.7
TkA05G429360	`PF05739`	SNARE	90	114	7.2e-06	26.5
TkA05G429360	`PF05739`	SNARE	138	155	7.2e-06	26.5
TkA05G429360	`PF10496`	Syntaxin-18_N	160	185	1.2e-17	64.7
TkA05G429360	`PF16789`	YscO-like	235	286	1.0	10.1
TkA05G429360	`PF05739`	SNARE	236	301	7.2e-06	26.5
TkA05G429360	`PF12397`	U3snoRNP10	241	299	0.055	14.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P59277`	Arabidopsis thaliana	sp\|P59277\|SYP81_ARATH Syntaxin-81	73.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card