LXL04_021884 | RubberDandelionOmics

Gene overview

LXL04_021884

Reference: OH-1004 Chr: Chr04 Coordinates: 139116896-139119452 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

966 bp · LXL04_021884|LXL04_021884|OH1004|cDNA

ATGGCTAAAGTTAGAGACAGAACCGAAGACTTCAAAGATGCTGTCAACAGGGGAGCTTTATCTTTAGGATTTAACGAGGCCAAAAGGGCAGCTCTAATGGCATCTTTCATCATGCACAAACCTCGTGAAAGATCACATTTTACCAAAGCTGCTTTAAAAACACTAGAAAGCATTGGGACTTTGGAACAGTTCTTGATAAAGCATAGAAAGGATTATGTAGATCCACATCGTACCACTGAAGAAGAAAGAGACAGCATTGA...

CDS

Download CDS FASTA

966 bp · LXL04_021884|LXL04_021884|OH1004|CDS

ATGGCTAAAGTTAGAGACAGAACCGAAGACTTCAAAGATGCTGTCAACAGGGGAGCTTTATCTTTAGGATTTAACGAGGCCAAAAGGGCAGCTCTAATGGCATCTTTCATCATGCACAAACCTCGTGAAAGATCACATTTTACCAAAGCTGCTTTAAAAACACTAGAAAGCATTGGGACTTTGGAACAGTTCTTGATAAAGCATAGAAAGGATTATGTAGATCCACATCGTACCACTGAAGAAGAAAGAGACAGCATTGA...

Protein

Download Protein FASTA

321 aa · LXL04_021884|LXL04_021884|OH1004|PROTEIN

MAKVRDRTEDFKDAVNRGALSLGFNEAKRAALMASFIMHKPRERSHFTKAALKTLESIGTLEQFLIKHRKDYVDPHRTTEEERDSIEHEVTLLELSLVSVFVKACKEQIDILKTSITDEESNAKGWLGIRADNSNLDTIAHKHGVVLILSETLHSVTSQFDQLRAVRFQEAINRAMPRRKPKPKPKLEKTSSNNIESTSSSEMRDPGEITTKPLKLQQQQLLDDETRALQVELSSLLDAARDTETKMVEMSALNHLMSTH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021884`
TK1151 ID	TkA05G429360
OH-1004 ID	LXL04_021884
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021884

Location Chr04:139116896-139119452 (-)

Description Similar to SYP81: Syntaxin-81

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g51740`	Vesicle trafficking protein that functions in the secretory pathway.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021884 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum Biological Process

GO:0015031 protein transport Biological Process

GO:0090158 endoplasmic reticulum membrane organization Biological Process

GO:1902117 positive regulation of organelle assembly Biological Process

GO:1902953 positive regulation of ER to Golgi vesicle-mediated transport Biological Process

GO:1903358 regulation of Golgi organization Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

KEGG gene cross-reference

ath:AT1G51740

dre:554130

hsa:53407

pon:100441033

rno:360953

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.484

Rank 1 · LXL04_021884 · OH-1004

Endoplasmic reticulum0.377

Rank 2 · LXL04_021884 · OH-1004

Cytoplasm0.206

Rank 3 · LXL04_021884 · OH-1004

Nucleus0.084

Rank 4 · LXL04_021884 · OH-1004

Lysosome / Vacuole0.079

Rank 5 · LXL04_021884 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10496.15Syntaxin-18_N5-86 aa

PF05739.27SNARE244-309 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021884	`PF10496.15`	Syntaxin-18_N	5	86	1.2e-17	64.6
LXL04_021884	`PF05739.27`	SNARE	244	309	7.6e-06	26.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P59277`	Arabidopsis thaliana	Syntaxin-81	72.586%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card