TkA05G405710 | RubberDandelionOmics

Gene overview

TkA05G405710

Reference: TK1151 Chr: Chr05 Coordinates: 100912749-100915543 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2261 bp · TkA05G405710|TK1151|cDNA

GGCCAATGGGGTCTTTGCTTTTCATCGATCAAAGTTGACGTGGCAAATTACAGCCATTCAGCGACACGATAGATATTTGTTTAGATTTTTTTGGTTCAGATATTTTGATTCATTTCATGTTTACAATAGATGATAACTTTTGCTTCTTTCAAACGAATCCAAGACATTTTGTAATCACCACAAACAAACAACCTCTCTCTCTCTCTCTCTCTCTGGCTCTCTTTTTTCTACACTTTTCTCGATCGGAAGTGAGTATGGGG...

CDS

Download CDS FASTA

1908 bp · TkA05G405710|TK1151|CDS

ATGTTTACAATAGATGATAACTTTTGCTTCTTTCAAACGAATCCAAGACATTTTGTAATCACCACAAACAAACAACCTCTCTCTCTCTCTCTCTCTCTGGCTCTCTTTTTTCTACACTTTTCTCGATCGGAAGTGAGTATGGGGGAAGCGTTAGTGAGCAGCAACGGCGGCGGGAAGATAGCTGACATGCCGGAGTTGTTGATGCGAAGTGAAGACAAGACGAACGATGGCGGTGGTGGTGACTCACCAACCACCGCCAT...

Protein

Download Protein FASTA

635 aa · TkA05G405710|TK1151|PROTEIN

MFTIDDNFCFFQTNPRHFVITTNKQPLSLSLSLALFFLHFSRSEVSMGEALVSSNGGGKIADMPELLMRSEDKTNDGGGGDSPTTAIATATNVVRWEKFLPKMSLRVLLVEADDCTRQIITALLRKCSYKVVAVSDGLKAWEVLKGKSQHIDLILTEVELPSISGFALLTLITEHQVCKNIPVIMMSAQDSVSTVYKCMLRGAADFLVKPVRKNELKNLWQHVWRRQASTAGVNGHQEESEADAQQKVEATAENNATSNR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G405710`
TK1151 ID	TkA05G405710
OH-1004 ID	LXL04_021557
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 92.756 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G405710

Location Chr05:100912749-100915543 (-)

Description Similar to APRR5: Two-component response regulator-like APRR5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g24470`	Transcriptional repressor of CCA1 and LHY, thereby controlling photoperiodic flowering response.	Circadian waves of expression of the APRR1/TOC1 family of pseudo-response regulators in Arabidopsis thaliana: insight into the plant circadian clock.2000 · DOI: 10.1093/pcp/pcd043
`At2g46790`	Transcriptional repressor of CCA1 and LHY, and positive regulator of LWD1 and LWD2 expression.	Circadian waves of expression of the APRR1/TOC1 family of pseudo-response regulators in Arabidopsis thaliana: insight into the plant circadian clock.2000 · DOI: 10.1093/pcp/pcd043
`At5g60100`	Controls photoperiodic flowering response.	Circadian waves of expression of the APRR1/TOC1 family of pseudo-response regulators in Arabidopsis thaliana: insight into the plant circadian clock.2000 · DOI: 10.1093/pcp/pcd043

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0532400`	Controls photoperiodic flowering response.	No verified direct reference in this release
`UniProt: A2XFB7`	Controls photoperiodic flowering response.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021557 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000160 phosphorelay signal transduction system Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009640 photomorphogenesis Biological Process

GO:0009736 cytokinin-activated signaling pathway Biological Process

GO:0010017 red or far-red light signaling pathway Biological Process

GO:0010114 response to red light Biological Process

GO:0010218 response to far red light Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0048511 rhythmic process Biological Process

GO:0051170 import into nucleus Biological Process

KEGG gene cross-reference

ath:AT2G46790

ath:AT5G24470

dosa:Os09g0532400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.933

Rank 1 · TkA05G405710 · TK1151

Cytoplasm0.111

Rank 2 · TkA05G405710 · TK1151

Cell membrane0.054

Rank 3 · TkA05G405710 · TK1151

Endoplasmic reticulum0.030

Rank 4 · TkA05G405710 · TK1151

Plastid0.015

Rank 5 · TkA05G405710 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00788RA102-127 aa

PF00072Response_reg107-218 aa

PF02045CBFB_NFYA454-454 aa

PF00788RA566-592 aa

PF02045CBFB_NFYA572-621 aa

PF06203CCT575-617 aa

PF09425Jas_motif575-597 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G405710	`PF00788`	RA	102	127	0.023	15.9
TkA05G405710	`PF00072`	Response_reg	107	218	4.7e-22	79.0
TkA05G405710	`PF02045`	CBFB_NFYA	454	454	4.8	8.2
TkA05G405710	`PF00788`	RA	566	592	0.023	15.9
TkA05G405710	`PF02045`	CBFB_NFYA	572	621	4.8	8.2
TkA05G405710	`PF06203`	CCT	575	617	1e-17	64.6
TkA05G405710	`PF09425`	Jas_motif	575	597	0.27	11.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6LA42`	Arabidopsis thaliana	sp\|Q6LA42\|APRR5_ARATH Two-component response regulator-like APRR5	40.000%	Swiss-Prot	Medium
`Q8L500`	Arabidopsis thaliana	sp\|Q8L500\|APRR9_ARATH Two-component response regulator-like APRR9	38.300%	Swiss-Prot	Medium
`Q9LVG4`	Arabidopsis thaliana	sp\|Q9LVG4\|APRR3_ARATH Two-component response regulator-like APRR3	31.900%	Swiss-Prot	Medium
`Q689G6`	Oryza sativa subsp. japonica	sp\|Q689G6\|PRR95_ORYSJ Two-component response regulator-like PRR95	35.400%	Swiss-Prot	Medium
`A2XFB7`	Oryza sativa subsp. indica	sp\|A2XFB7\|PRR73_ORYSI Two-component response regulator-like PRR73	48.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card