TkA05G393150 | RubberDandelionOmics

Gene overview

TkA05G393150

Reference: TK1151 Chr: Chr05 Coordinates: 97703443-97706256 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1904 bp · TkA05G393150|TK1151|cDNA

AAAAATTCTAAGATAAGCCAAATGTAACCAAAATGTTCGGTTTCCGCATCTGCTCGAAGTCTATAAACCAAAAACAAAAACATCCCAAAACGGAAAGCATGTAAGCGCGAGGAACAGCAAGAAAACCCTAAACCATTAAACTTTGCAGTGTGTAGTAGGGGAGATTTATGGCGACAGAAAGTTCTAGATCGTCAAGCTCGTCAGCCGATTCGTATATCGGAAGCTTGATCAGCTTGACGTCCAAGAGTGAAATTAGATAC...

CDS

Download CDS FASTA

1458 bp · TkA05G393150|TK1151|CDS

ATGGCGACAGAAAGTTCTAGATCGTCAAGCTCGTCAGCCGATTCGTATATCGGAAGCTTGATCAGCTTGACGTCCAAGAGTGAAATTAGATACGAGGGCATTTTGTATAACATCAACACTGAAGAATCCTCAATTGGATTGCGTAACGTAAGATCATTTGGAACTGAAGGGAGAAAAAAGGATGGCCCCAAACTCATGCCTAGCGACAAAGTTTATGAATACATATTGTTTCGTGGAAGTGACATCAAGGATCTTCAGGT...

Protein

Download Protein FASTA

485 aa · TkA05G393150|TK1151|PROTEIN

MATESSRSSSSSADSYIGSLISLTSKSEIRYEGILYNINTEESSIGLRNVRSFGTEGRKKDGPKLMPSDKVYEYILFRGSDIKDLQVKSSLPIQPTQPIINNDPAIIQSHYPISSTPTNSLPDMSIQNPPTLQGGPGPPLYSPGPNPGAWAPMPPHPNPTSTGLPMPPMYWPGFYGPPNGVPQLHQQLLRPPLQYPVYNRSLPGGSPLLATDTLPSLMQNKPPDFVGPTESLPTRTRTPSLVTPGQLLQSAVDSEEEAVQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G393150`
TK1151 ID	TkA05G393150
OH-1004 ID	LXL04_021411
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.800
Protein coverage (%)	TK1151 85.361 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G393150

Location Chr05:97703443-97706256 (-)

Description Similar to DCP5: Protein decapping 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g26110`	As a component of the decapping complex, involved in the degradation of mRNAs.	Arabidopsis decapping 5 is required for mRNA decapping, P-body formation, and translational repression during postembryonic development.2009 · DOI: 10.1105/tpc.109.070078
`At5g45330`	As a component of the decapping complex, involved in the degradation of mRNAs.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021411 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0010606 positive regulation of cytoplasmic mRNA processing body assembly Biological Process

GO:0017148 negative regulation of translation Biological Process

GO:0031087 deadenylation-independent decapping of nuclear-transcribed mRNA Biological Process

GO:0033962 P-body assembly Biological Process

GO:0034063 stress granule assembly Biological Process

GO:0090307 mitotic spindle assembly Biological Process

GO:0000932 P-body Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

GO:0072686 mitotic spindle Cellular Component

KEGG gene cross-reference

ath:AT1G26110

ath:AT5G45330

pon:100173930

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.729

Rank 1 · TkA05G393150 · TK1151

Nucleus0.355

Rank 2 · TkA05G393150 · TK1151

Cell membrane0.055

Rank 3 · TkA05G393150 · TK1151

Endoplasmic reticulum0.039

Rank 4 · TkA05G393150 · TK1151

Mitochondrion0.034

Rank 5 · TkA05G393150 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14438SM-ATX14-88 aa

PF12701LSM1416-89 aa

PF07172GRP300-322 aa

PF09532FDF327-439 aa

PF12540DUF3736365-424 aa

PF07172GRP431-474 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G393150	`PF14438`	SM-ATX	14	88	7.1e-12	46.1
TkA05G393150	`PF12701`	LSM14	16	89	4.8e-32	110.5
TkA05G393150	`PF07172`	GRP	300	322	0.07	14.5
TkA05G393150	`PF09532`	FDF	327	439	3e-16	60.8
TkA05G393150	`PF12540`	DUF3736	365	424	0.51	11.0
TkA05G393150	`PF07172`	GRP	431	474	0.07	14.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C658`	Arabidopsis thaliana	sp\|Q9C658\|DCP5_ARATH Protein decapping 5	42.200%	Swiss-Prot	Medium
`Q9FH77`	Arabidopsis thaliana	sp\|Q9FH77\|DCP5L_ARATH Decapping 5-like protein	30.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card