LXL04_021411 | RubberDandelionOmics

Gene overview

LXL04_021411

Reference: OH-1004 Chr: Chr04 Coordinates: 129092137-129100786 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1449 bp · LXL04_021411|LXL04_021411|OH1004|cDNA

ATGGCGACAGAAAGTTCTAGATCGTCAAGCTCGTCAGCCGATTCGTATATCGGAAGCTTGATCAGCTTGACGTCCAAGAGTGAAATTAGATACGAGGGCATTTTGTATAACATCAACACTGAAGAATCCTCAATTGGATTGCGTAACGTAAGATCATTTGGAACTGAAGGGAGAAAAAAGGATGGCCCCAAACTCATGCCTAGCGACAAAGTTTATGAATACATATTGTTTCGTGGAAGTGACATCAAGGATCTTCAGGT...

CDS

Download CDS FASTA

1239 bp · LXL04_021411|LXL04_021411|OH1004|CDS

ATGGCGACAGAAAGTTCTAGATCGTCAAGCTCGTCAGCCGATTCGTATATCGGAAGCTTGATCAGCTTGACGTCCAAGAGTGAAATTAGATACGAGGGCATTTTGTATAACATCAACACTGAAGAATCCTCAATTGGATTGCGTAACGTAAGATCATTTGGAACTGAAGGGAGAAAAAAGGATGGCCCCAAACTCATGCCTAGCGACAAAGTTTATGAATACATATTGTTTCGTGGAAGTGACATCAAGGATCTTCAGGT...

Protein

Download Protein FASTA

412 aa · LXL04_021411|LXL04_021411|OH1004|PROTEIN

MATESSRSSSSSADSYIGSLISLTSKSEIRYEGILYNINTEESSIGLRNVRSFGTEGRKKDGPKLMPSDKVYEYILFRGSDIKDLQVKSSLPIQPTQPIINNDPAIIQSHYPISSTPTNSLPDMSIQNPPTLQGGPGPPLYSPGPNPGAWAPMPPHPNPTSTGLPMPPMYWPGFYGPPNGVPQLHQQLLRPPLQYPVYNRSLPGGSPLLATDTLPSLMQNKPPDFVGPTESLPTRTPSLVTPGQLLQSAVDSEEEAVQVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021411`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021411

Location Chr04:129092137-129100786 (-)

Description Similar to DCP5: Protein decapping 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g26110`	As a component of the decapping complex, involved in the degradation of mRNAs.	Arabidopsis decapping 5 is required for mRNA decapping, P-body formation, and translational repression during postembryonic development.2009 · DOI: 10.1105/tpc.109.070078
`At5g45330`	As a component of the decapping complex, involved in the degradation of mRNAs.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021411 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0010606 positive regulation of cytoplasmic mRNA processing body assembly Biological Process

GO:0017148 negative regulation of translation Biological Process

GO:0031087 deadenylation-independent decapping of nuclear-transcribed mRNA Biological Process

GO:0033962 P-body assembly Biological Process

GO:0034063 stress granule assembly Biological Process

GO:0090307 mitotic spindle assembly Biological Process

GO:0000932 P-body Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

GO:0072686 mitotic spindle Cellular Component

KEGG gene cross-reference

ath:AT1G26110

ath:AT5G45330

pon:100173930

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.717

Rank 1 · LXL04_021411 · OH-1004

Nucleus0.340

Rank 2 · LXL04_021411 · OH-1004

Cell membrane0.065

Rank 3 · LXL04_021411 · OH-1004

Golgi apparatus0.042

Rank 4 · LXL04_021411 · OH-1004

Endoplasmic reticulum0.041

Rank 5 · LXL04_021411 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14438.13SM-ATX14-88 aa

PF12701.14LSM1416-89 aa

PF09532.16FDF325-411 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021411	`PF14438.13`	SM-ATX	14	88	6.6e-12	46.2
LXL04_021411	`PF12701.14`	LSM14	16	89	3.7e-32	110.9
LXL04_021411	`PF09532.16`	FDF	325	411	5.2e-13	50.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C658`	Arabidopsis thaliana	Protein decapping 5	63.551%	Swiss-Prot	weak database homology
`Q9FH77`	Arabidopsis thaliana	Decapping 5-like protein	56.410%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card