TkA05G388170 | RubberDandelionOmics

Gene overview

TkA05G388170

Reference: TK1151 Chr: Chr05 Coordinates: 96434310-96439512 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2366 bp · TkA05G388170|TK1151|cDNA

ATTTTCCAGGCTACAATCCCGGCACGTGATAGCAACTCCGCATGTCATTTGTGGTCGTTATTATCCCATCCACTCTAACTCATTCATCTCCACTGGGAATACCTGAATAACTCTCCTAAAACTCCACTTTGGTTTATCTCCCCCACACAAAATCATATGTGCTGCACAAAAACAAGAACACAGAGAGGTGTTACTGTTTCAAATTCAAGCAAGATCCAGCTGAAAAGAAAAGAGTATATGTAAATGTAAATATGTACGTA...

CDS

Download CDS FASTA

1899 bp · TkA05G388170|TK1151|CDS

ATGTACGTACATACATCGACTGATATGGCAACTGTAGCAGCAGCAGCAGGAGTAGGACTAGGATTTGGAGGTGGTTCCTTAAACCTCCACTCCCTCAATTCGTTTCCACCATCTCCATTTTTAGGCAAAAGGTTAAAACTCAAGCCTTTACAAGAAACAACTTCACATGGATCAAAAGTCACAGTCTTCCGGCCAAATTTACACTCAACTGTTGTCGCTGGATTTCAATTGGTTAATTATGTTCATGATGTTTTCTTGGG...

Protein

Download Protein FASTA

632 aa · TkA05G388170|TK1151|PROTEIN

MYVHTSTDMATVAAAAGVGLGFGGGSLNLHSLNSFPPSPFLGKRLKLKPLQETTSHGSKVTVFRPNLHSTVVAGFQLVNYVHDVFLGVGVGLPCTVMECGDMIYRSTLPKSNALTLTIPGAVLALGTLSYLWATPGVAPGFWDMFVLAFVERLFRPTYKKEGDLVLKKATEYGAVEIWMNERVRRACANSCADFLYGFLEKSSKKEAEYWLIWRFEGESTLAELIQSKEFPYNVESMILGEVQDLPKGLERENRIIQTVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G388170`
TK1151 ID	TkA05G388170
OH-1004 ID	LXL04_035943
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	42.900
Protein coverage (%)	TK1151 50.316 / OH-1004 63.147 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G388170

Location Chr05:96434310-96439512 (+)

Description Similar to STN8: Serine/threonine-protein kinase STN8, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g68830`	Serine/threonine protein kinase required for state transition by phosphorylating light-harvesting complex II outer antennae (LCHII).	State transitions and light adaptation require chloroplast thylakoid protein kinase STN7.2005 · DOI: 10.1038/nature03286 Photosystem II core phosphorylation and photosynthetic acclimation require two different protein kinases.2005 · DOI: 10.1038/nature04016 State transitions revisited-a buffering system for dynamic low light acclimation of Arabidopsis.2006 · DOI: 10.1007/s11103-006-9044-8 Intrinsically unstructured phosphoprotein TSP9 regulates light harvesting in Arabidopsis thaliana.2009 · DOI: 10.1021/bi8016334 Arabidopsis STN7 kinase provides a link between short- and long-term photosynthetic acclimation.2009 · DOI: 10.1105/tpc.108.064964 Phosphoproteomics of Arabidopsis chloroplasts reveals involvement of the STN7 kinase in phosphorylation of nucleoid protein pTAC16.2012 · DOI: 10.1016/j.febslet.2012.03.061
`At5g01920`	May phosphorylate proteins of the photosystem II core complex.	STN8 protein kinase in Arabidopsis thaliana is specific in phosphorylation of photosystem II core proteins.2005 · DOI: 10.1074/jbc.m505729200 Photosystem II core phosphorylation and photosynthetic acclimation require two different protein kinases.2005 · DOI: 10.1038/nature04016 Light regulation of CaS, a novel phosphoprotein in the thylakoid membrane of Arabidopsis thaliana.2008 · DOI: 10.1111/j.1742-4658.2008.06335.x Visualizing the mobility and distribution of chlorophyll proteins in higher plant thylakoid membranes: effects of photoinhibition and protein phosphorylation.2010 · DOI: 10.1111/j.0960-7412.2010.04207.x
`At2g38620`	Together with CDKB1-1, promotes both the last division in the stomatal cell lineage as well as the number of stomata.	No verified direct reference in this release
`At3g54180`	May control G2/M (mitosis) phase progression.	An Arabidopsis cell cycle -dependent kinase-related gene, CDC2b, plays a role in regulating seedling growth in darkness.1999 · DOI: 10.1105/tpc.11.10.1883

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035943 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007623 circadian rhythm Biological Process

GO:0009643 photosynthetic acclimation Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0042149 cellular response to glucose starvation Biological Process

GO:0042548 regulation of photosynthesis, light reaction Biological Process

GO:0042549 photosystem II stabilization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009579 thylakoid Cellular Component

KEGG gene cross-reference

ath:AT1G12680

ath:AT1G68830

ath:AT5G01920

mmu:381393

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.955

Rank 1 · TkA05G388170 · TK1151

Nucleus0.040

Rank 2 · TkA05G388170 · TK1151

Mitochondrion0.037

Rank 3 · TkA05G388170 · TK1151

Cytoplasm0.030

Rank 4 · TkA05G388170 · TK1151

Cell membrane0.022

Rank 5 · TkA05G388170 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07714PK_Tyr_Ser-Thr208-327 aa

PF13095FTA2235-287 aa

PF00069Pkinase251-327 aa

PF01636APH251-300 aa

PF17667Pkinase_fungal259-305 aa

PF00069Pkinase358-452 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G388170	`PF07714`	PK_Tyr_Ser-Thr	208	327	0.00063	19.8
TkA05G388170	`PF13095`	FTA2	235	287	0.011	16.2
TkA05G388170	`PF00069`	Pkinase	251	327	9.1e-20	71.9
TkA05G388170	`PF01636`	APH	251	300	0.051	14.0
TkA05G388170	`PF17667`	Pkinase_fungal	259	305	0.027	13.9
TkA05G388170	`PF00069`	Pkinase	358	452	9.1e-20	71.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9S713`	Arabidopsis thaliana	sp\|Q9S713\|STT7_ARATH Serine/threonine-protein kinase STN7, chloroplastic	75.200%	Swiss-Prot	High
`Q9LZV4`	Arabidopsis thaliana	sp\|Q9LZV4\|STN8_ARATH Serine/threonine-protein kinase STN8, chloroplastic	43.100%	Swiss-Prot	Low
`Q2V419`	Arabidopsis thaliana	sp\|Q2V419\|CKB12_ARATH Cyclin-dependent kinase B1-2	30.600%	Swiss-Prot	Low
`P25859`	Arabidopsis thaliana	sp\|P25859\|CKB11_ARATH Cyclin-dependent kinase B1-1	28.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card